Graphical abstract
The potential protective mechanisms of MT on hepatic OS in PCOS. MT could lead to a decrease in autophagy, presenting a decrease of LC3 and an increase of P62 in the PCOS liver. Increased P62 could reduce Nrf2 ubiquitination and increase its nuclear translocation and activation through direct interaction with Keap1. Thus, MT ultimately activated the Keap1-Nrf2 pathway, promoting nuclear Nrf2 expression to reduce hepatic OS.
Abstract
The elevated level of hepatic oxidative stress (OS) in polycystic ovary syndrome (PCOS) is one of the important causes of liver abnormalities. Therefore, decreasing the level of hepatic OS in PCOS is beneficial in reducing the risk of PCOS-related liver diseases. Melatonin (MT) is recognized as a potent antioxidant. Nevertheless, the efficacy of MT in alleviating hepatic OS associated with PCOS is yet to be established, and the precise mechanisms through which MT exerts its antioxidant effects remain to be fully elucidated. The aim of this study was to explore the potential mechanisms by which MT reduces hepatic OS in PCOS. First, we detected elevated OS levels in PCOS samples. Subsequently, with MT pretreatment, we discovered that MT could significantly diminish the levels of OS, liver triglycerides, total cholesterol, alanine aminotransferase, and aspartate aminotransferase, while concurrently ameliorating mitochondrial structural damage in the PCOS liver. Furthermore, we identified elevated autophagy levels in the liver of PCOS rats and an inhibition of the Keap1–Nrf2 pathway. Through MT pretreatment, the expression of LC3 was significantly decreased, while the Keap1–Nrf2 pathway was activated. Our study showed that MT could affect the Nrf2 pathway dependent on the P62/LC3 autophagy pathway, thereby attenuating hepatic OS in PCOS. These findings offer novel insights and research avenues for the study of PCOS-related liver diseases.
Introduction
Polycystic ovary syndrome (PCOS) is one of the most common female reproductive endocrine diseases. Recently, the global incidence rate has been as high as 15% (1). PCOS causes significant harm that seriously affects female reproductive and metabolic functions. The main clinical manifestations include menstrual disorders, ovulation disorders, insulin resistance, and hyperandrogenemia. Although many studies have focused on PCOS, the specific cause of PCOS is still unclear (2).
Oxidative stress (OS) is a state characterized by pro-oxidant molecules and antioxidant defense imbalance, including that of reactive oxygen species and nitrogen species. OS participates in the development process of PCOS, and PCOS also promotes OS (3). Studies have shown that abnormal insulin metabolism in PCOS, as evidenced by decreased hepatic insulin extraction as well as abnormal insulin receptor signaling, promotes the development of OS (4). OS is one of the important causes of liver abnormalities in liver-related diseases of PCOS (5). A higher incidence of nonalcoholic fatty liver disease (NAFLD) is often associated with PCOS. OS, insulin resistance, and high androgen levels in PCOS commonly play a key role in the pathogenesis of NAFLD (6). Therefore, the risks of liver diseases related to PCOS might be partly reduced by resisting OS.
Autophagy is a process characterized by the formation of autophagosomes (7). It eliminates discarded proteins and organelles to maintain homeostasis and survival within the intracellular environment, performing an important regulatory function in the occurrence and development of many diseases, including PCOS (8). In addition to the indispensable role of starvation-induced autophagy in liver diseases, basic and selective autophagy also helps to effectively control the quality of organelles and cytoplasmic proteins in hepatocytes (9). Autophagy plays a key role in regulating the physiological and homeostatic aspects of the liver (10). Impairment of autophagic function can lead to the occurrence of various liver diseases (11). Moreover, autophagy also participates in the antioxidant process of the liver.
Autophagy can regulate OS. A recent study showed that uncoordinated 51-like kinase 1 (ULK1) could limit cytotoxicity and hepatic OS induced by saturated fat through autophagy (12). In addition, it activates the nuclear factor-erythroid-2-related factor 2 (Nrf2) antioxidant reaction by degrading Kelch-like ECH-associated protein 1 (Keap1). OS mediated by the Keap1–Nrf2 pathway is the core mechanism for regulating the oxidant–antioxidant balance. Recent research suggests that the autophagy-associated protein P62 can reduce Nrf2 ubiquitination, increase its nuclear translocation and activation, and improve antioxidant stress ability through direct interaction with Keap1 (13).
Melatonin (MT), a lipophilic indole amine hormone, exhibits a circadian secretion pattern originating from the pineal gland (14). Our previous investigations have substantiated its significant therapeutic potential in ameliorating ovarian dysfunction associated with PCOS (15). Notably, MT biosynthesis also occurs in the liver, and its receptors (G protein-coupled receptors MT1A and MT1B) are variably expressed across hepatocytes and influenced by MT levels (16). Moreover, MT can scavenge reactive oxygen species (ROS) and control the endogenous oxidative state of cells by indirectly stimulating certain antioxidant enzymes, such as superoxide dismutase (SOD) (17). MT has been found to ameliorate the development of diet-induced NAFLD by modulating lipid metabolism, attenuating OS, and inhibiting stellate cell activation (18, 19, 20). Given the intimate interplay between MT, autophagy, and OS, it is conceivable that MT may alleviate hepatic OS in PCOS by regulating autophagy.
This study aims to explore whether MT activates the Keap1–Nrf2 pathway through autophagy, thereby reducing the level of hepatic OS in PCOS, eventually paving new avenues and perspectives for investigating liver diseases associated with PCOS.
Materials and methods
Ethics authorization
This study received approval from the Medical Ethics Committee of the First Affiliated Hospital of Anhui Medical University. The assigned protocol number for animal subjects was LLSC20170062, while that for human subjects was 20170046. All animal experiments and nursing procedures were carried out in compliance with the animal experimental guidelines of Anhui Medical University.
Population sample collection
All the participants were 25- to 31-year-old women who received medical treatments at the First Affiliated Hospital of Anhui Medical University from April 2023 to May 2023. Informed consent was obtained from all patients before starting the study. Samples were collected from both the non-PCOS group and the PCOS population, with a standard body mass index (BMI) of 18.5–24.9 kg/m2. The diagnostic criteria for PCOS met the Rotterdam Consensus Conference (ESHRE/ASRM 2003). Women who were unable to conceive naturally due to male infertility or tubal disease alone but had normal ovulation cycles were considered part of the non-PCOS group. Each group contained 20 patients who voluntarily underwent in vitro fertilization or intracytoplasmic sperm injection to achieve pregnancy. Their sera were collected while they were fasting. The clinical characteristics of the PCOS group and non-PCOS group are presented in Table 1.
Clinical features of PCOS and non-PCOS group.
| Clinical parameter | Non-PCOS (n = 20) | PCOS (n = 20) |
|---|---|---|
| Age (years) | 28.50 ± 1.61 | 27.50 ± 2.01 |
| BMI (kg/m2) | 20.80 ± 1.78 | 21.86 ± 1.48 |
| FSH (IU/L) | 6.52 ± 1.32 | 6.03 ± 1.57 |
| LH (IU/L) | 4.68 ± 1.55 | 11.01 ± 7.54a |
| LH/FSH | 0.73 ± 0.22 | 1.79 ± 1.02a |
| T (nmol/L) | 0.63 ± 0.29 | 2.71 ± 0.49a |
| P (nmol/L) | 1.43 ± 1.55 | 3.15 ± 1.76 |
| PRL (ng/mL) | 15.41 ± 8.15 | 15.10 ± 6.51 |
| E2 (pmol/L) | 113.70 ± 74.54 | 163.88 ± 0.05 |
Serum levels of LH, LH/FSH, and T were significantly higher in the PCOS group compared to the non-PCOS group.
aP < 0.01 vs non-PCOS.
BMI, body mass index; E2, estradiol; FSH, follicle-stimulating hormone; LH, luteinizing hormone; PCOS, polycystic ovary syndrome; P, progesterone; PRL, prolactin; T, testosterone.
PCOS rat model
From Beijing Vital River Laboratory Animal Technology Co., Ltd., 60 female Sprague‒Dawley rats (25 days old) were purchased. They were housed in a standard specific pathogen-free animal laboratory. For 3–5 days, the rats were subjected to a 12-h light:12-h darkness cycle at a room temperature of 20–24°C and humidity of 60–65%. After 3 days of acclimation, the rats were randomly divided into four groups: the control group, the MT group, DHEA group, and DHEA + MT group. In the control group, saline (1 mL/100 g body weight) was administered intragastrically at 08:30 h, followed by a subcutaneous injection of corn oil (0.1 mL/100 g body weight, Sigma) at 09:30 h. For the MT group, MT (5 mg/100 g body weight, Sigma) was administered intragastrically at 08:30 h, with a corn oil injection at 09:30 h. In the DHEA group, saline was administered intragastrically at 08:30 h, and DHEA (6 mg/100 g body weight, MCE) dissolved in corn oil was injected at 09:30 h. Finally, in the DHEA + MT group, MT was administered intragastrically at 08:30 h, followed by a subcutaneous injection of DHEA at 09:30 h. This protocol was followed for 20 consecutive days.
Vaginal smears
Starting from the 10th day of PCOS modeling, vaginal secretions from the rats were collected and observed under an optical microscope between 08:00 h and 09:00 h. Three types of cells were identified. Cells with a round shape possessing nuclei were classified as epithelial cells; cells with an irregular shape lacking nuclei were termed keratinized cells; and small round cells were identified as white blood cells. The stages of the estrous cycle were determined based on the ratios among these cells.
Cell culture and treatment
HepG2 cells were cultured in high glucose DMEM with the addition of 10% fetal bovine serum (Gibco), 0.1 mg/mL streptomycin, and 100 units/mL penicillin G (Beyotime). The cells were seeded into a six-well plate at a density of 2.0 × 105 cells per well. Subsequently, the cells were treated for 48 h with H2O2 (400 µΜ, Sigma), MT (200 µΜ, Sigma), rapamycin (50 nM, MCE), ML385 (5 µM, MCE), and TBHQ (50 µM, MCE), either individually or in combination.
Hematoxylin-eosin staining
The liver and ovarian sections of the rats were dewaxed using xylene and then stained successively with hematoxylin and eosin dyes. The slices were then dehydrated, made transparent, and sealed. Images were collected and analyzed using a 3D digital slicing scanner (Pannoramic MIDI, 3DHISTECH).
Real-time qPCR analysis
Total RNA from rat liver was extracted with HyperPure RNA Isolation Kit (EnzyArtisan). The concentration of total RNA was assessed through absorbance spectroscopy (Nanodrop ND-2000, Thermo Fisher). This was followed by the conversion of RNA to cDNA with HyperScript III RT SuperMix (EnzyArtisan). Real-time qPCR analysis was performed using 2× SYBR Green I Master (Roche Diagnostics GmbH) with the LightCycler 480 real-time PCR system. All primers were synthesized and purified by EnzyArtisan. The primer sequences were as follows: beta-actin: GACGTTGACATCCGTAAAGACC (F), CTAGGAGCCAGGGCAGTAATCT (R); MT1A: GGATGGAACCTGGGATATCTGC (F), GTTGAATACCGAGCCAATGACAC (R); MT1B: ACCTGCGAATATGGATACTGGTG (F), CCACAAACACTGCGAACATGG (R). All qPCRs were carried out in a final volume of 20 μL.
Immunohistochemical staining
Paraffin sections of rat liver were dewaxed and dehydrated, followed by antigen retrieval, endogenous peroxidase blocking, and primary antibody application. The specific primary antibodies used in immunohistochemistry (IHC) were as follows: Keap1 (1:100, rabbit monoclonal; Affinity, #AF5266), Nrf2 (1:100, rabbit monoclonal; Affinity, #AF0639), HO-1 (1:200, rabbit monoclonal; Proteintech, 10701-1-AP), SOD1 (1:800, rabbit monoclonal; Proteintech, 10269-1-AP), and SOD2 (1:1000, rabbit monoclonal; Proteintech, 24127-1-AP). Next, the enzyme-labeled goat anti-mouse/rabbit IgG polymer was added, and the slices were then dehydrated with alcohol, made transparent with xylene, and finally sealed with neutral gum. Images were collected and analyzed using a 3D digital slicing scanner (Pannoramic MIDI, 3DHISTECH).
Immunofluorescence staining
To detect the levels of OS and autophagy in the liver and HepG2 cells, liver paraffin sections and HepG2 cells were used to detect HO-1 (1:200, rabbit monoclonal; Proteintech, 10701-1-AP), SOD1 (1:50, rabbit monoclonal; Proteintech, 10269-1-AP), SOD2 (1:100, rabbit monoclonal; Proteintech, 24127-1-AP), P62 (1:100, mouse monoclonal; Abcam, ab56416), and LC3B (1:100, rabbit monoclonal; Sigma, L7543) indicators. They were then incubated overnight at 4°C. Following this, a thorough washing was performed three times, and the sections were subsequently incubated with a goat anti-mouse/rabbit IgG secondary antibody (1:250, Immunoway, RS3608, RS0004) for 60 min at 37°C. DAPI was utilized to stain the nuclei, and the cells were washed three additional times with PBS. Finally, the slides were incubated with an anti-fluorescence quencher. The stained cells were observed under a fluorescence microscope (Thunder Image, 3D Assay).
Detection of apoptosis by TUNEL assay
First, the liver paraffin sections are subjected to a dewaxing treatment. Then, the permeability of the sample is increased. Next, the labeling reaction solution (AT005, 7seabiotech) is prepared, and the labeling reaction is performed. Finally, the reaction is terminated, and the results are evaluated. The PI nuclear stain can color the DNA of all labeled and unlabelled cells red, with only the apoptotic cells containing FITC-dUTP incorporation and localization showing green fluorescence.
Transmission electron microscopy
Several pieces of 1 mm3 liver tissue were obtained and immediately fixed in phosphate buffer containing 2.5% glutaraldehyde for 12 h. After that, they were fixed with 1% osmic acid for 1–2 h. These tissues were dehydrated using a gradient ethanol series and embedded in epoxy resin. The resin-coated blocks were then cut into 70 nm ultrathin slices using an ultrathin microtome (UC-7, Leica). Images of the ultrathin sections were taken using a transmission electron microscope (TEM) (JEM1400Flash) while they were mounted on a copper mesh.
Biochemical analysis
The contents of malondialdehyde (MDA) in the samples were determined using a thiobarbituric acid detection kit. A multifunctional enzyme labeler (MD/SpectraMAX ID3) was used to measure the optical density at 532 nm. The activity of glutathione peroxidase (GSH-PX) was expressed in terms of the rate of its enzymatic reaction. Catalase (CAT) and SOD activities were respectively determined by the ammonium molybdate method and the WST-1 method. To calculate the oxidized glutathione (GSSG)/glutathione (GSH) ratio, total GSH and its oxidized form (GSSG) were spectrophotometrically evaluated by monitoring the change in absorbance at 405 nm. Liver triglyceride (TG) and total cholesterol (TC) levels were respectively measured by the GPO-PAP enzymatic method and the COD-PAP method. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were measured using the Reitman–Frankel method to assess liver function. The optical density value was respectively measured at 505 nm and 510 nm according to the instructions of the test kits (Nanjing Institute of Jiancheng Bioengineering).
Western blotting
The specific methods for protein extraction from rat liver tissue and HepG2 cells were described in previous studies (15). The protein samples were added to a 10% or 12% SDS-PAGE gel for electrophoresis and then transferred onto a PVDF membrane. After that, the PVDF membrane was incubated with primary antibody overnight. The primary antibodies used were as follows: LC3B (1:1000, rabbit monoclonal; Sigma, L7543), Beclin1 (1:1000, rabbit monoclonal; Cell Signaling Technology, D40C5), P62 (1:1000, mouse monoclonal; Abcam, ab56416), Nrf2 (1:1000, rabbit monoclonal; Affinity, #AF0639), Keap1 (1:500, rabbit monoclonal; Affinity, #AF5266), HO-1 (1:1000, rabbit monoclonal; Proteintech, 10701-1-AP), SOD1 (1:5000, rabbit monoclonal; Proteintech, 10269-1-AP), SOD2 (1:5000, rabbit monoclonal; Proteintech, 24127-1-AP), GAPDH (1:5000, mouse monoclonal; Immunoway, YM3029), and Lamin B1 (1:5000, rabbit monoclonal; Abcam, ab16048). The PVDF membrane was then washed and incubated with a horseradish peroxidase–labeled secondary antibody (1:10,000, Bioworld, BS12478, BS13278) at room temperature for 1 h. The target bands were observed using ECL chemiluminescence substrate (Biosharp) and quantified using ImageJ software (version 1.46). GAPDH and Lamin B1 were used as internal parameters to calculate protein expression.
Statistical analysis
The results are presented as the mean ± s.d. for continuous variables. Statistical data were determined by t-test and one-way ANOVA using SPSS 17.0 software. A P value <0.05 was considered statistically significant. All experiments were replicated three times.
Results
The increased OS levels of serum in the human PCOS group
To investigate the changes in OS in PCOS patients, we used the biochemical process to assess the concentration of the lipid peroxidation product MDA, the GSSG/GSH ratio, and antioxidant enzymes SOD, GSH-PX, and CAT in serum samples. Significantly elevated levels of MDA and the GSSG/GSH ratio, along with decreased levels of SOD, GSH-PX, and CAT, were found in PCOS patients (Fig. 1A, B, C, D, and E). Subsequent measurement of serum levels of ALT and AST found significantly higher activities in the PCOS group (Fig. 1F and G). This finding suggested a potential link between increased OS levels and liver function abnormalities in PCOS.
Increased levels of OS in the serum of the human PCOS group.(A–E)Changes in the contents of MDA, antioxidant enzymes SOD, GSH-PX, CAT, and the GSSG/GSH ratio in the serum of humans in two groups (n = 20). (F–G) ALT and AST levels in serum in two groups (n = 20). Data were presented as the mean ± s.d. *P < 0.05 vs control; **P < 0.01 vs control.
Citation: Endocrine Connections 13, 12; 10.1530/EC-24-0303
MT reduced OS in the livers of PCOS rats
To explore OS in the PCOS liver, we used DHEA to establish a PCOS rat model. We observed typical morphological changes resembling polycystic ovarian characteristics (Fig. 2A) and irregular estrus cyclicity (Fig. 2B). Histological analysis of the ovarian follicles revealed that the DHEA group had fewer corpus luteum and antral follicles, alongside increased atretic follicles, compared to the control group (Fig. 2A). The pathological results showed that the hepatic cords in the hepatic tissues of mice in the DHEA group were irregular (Fig. 2D). There was no statistically significant difference in MT1A mRNA levels; however, MT was able to restore the DHEA-decreased MT1B levels (Fig. 2C). Next, we continued to analyze the effects of MT on hepatic OS in PCOS. IHC, western blotting, immunofluorescence, and biochemical processes were applied to detect OS-related indicators in the liver tissues and serum. Specifically, we observed a decrease in the expression levels of HO-1 and SOD2 in the DHEA group. In alignment with clinical samples, the DHEA group exhibited significantly elevated MDA concentrations and a higher GSSG/GSH ratio, coupled with decreased levels of SOD, GSH-PX, and CAT levels, thereby recapitulating the observed profile of OS in PCOS patients. However, the expression levels of SOD, GSH-PX, and CAT were significantly increased in the DHEA + MT group (Fig. 2E, F, G, H, I, and J), showing that MT might alleviate hepatic OS in PCOS rats. Finally, we demonstrated that MT treatment effectively alleviated hepatic lipid abnormalities and subsequently restored liver function, as evidenced by a reduction in TC, TG, ALT, and AST concentrations (Fig. 2K and L).
MT attenuated hepatic OS in PCOS rats. The rats were randomly divided into four groups: control group, MT group, DHEA group, and DHEA + MT group. (A) Morphological changes of ovaries in the two groups with HE staining. Scale bar: 200 μm. *, corpus luteum; #, cystic follicle; AF, antral follicles; Atr F, atretic follicles (n = 3).(B) Estrus cyclicities in two groups (n = 3). (C) Relative mRNA levels of MT1A and MT1B in rat livers of the four groups (n = 3). (D) Morphological structures of rat livers in the four groups with HE staining. →: hepatic cords. Scale bar: 50 μm (n = 3). (E)Immunohistochemistry analysis of HO-1, SOD1, and SOD2 in rat livers of the four groups. Scale bar: 50 μm (n = 3). (F)Western blot analysis of HO-1, SOD1, and SOD2 expressions in rat livers of four groups (n = 3). (G–I)Immunofluorescent staining of HO-1, SOD1, and SOD2 in rat livers of the four groups. Scale bar: 20 μm (n = 3). (J) Changes in the contents of MDA and antioxidant enzymes SOD, GSH-PX, CAT, and the GSSG/GSH ratio in rat livers and serum of the four groups (n = 5). (K) Changes in the contents of TC and TG in rat livers of the four groups (n = 5). (L) ALT and AST levels in rat serum of the four groups (n = 5). Data were presented as the mean ± s.d. *P < 0.05 vs control; **P < 0.01 vs control; #P < 0.05 vs DHEA; ##P < 0.01 vs DHEA.
Citation: Endocrine Connections 13, 12; 10.1530/EC-24-0303
MT ameliorated hepatic mitochondrial structural damage in PCOS rats
TEM was used to examine the ultrastructural changes in rat liver tissues. As shown in Fig. 3A, the DHEA group exhibited a loss of mitochondrial quantity, mitochondrial membrane rupture, blurred mitochondrial cristae, twisted and fractured rough endoplasmic reticulum, and increased autophagosomes. Conversely, the ultrastructure and quantity of the mitochondria were restored, and the fracture of the rough endoplasmic reticulum was improved significantly with pretreatment with MT. There was no significant difference in TUNEL positivity observed in the immunofluorescence staining of liver sections from rats (Fig. 3B).
MT attenuated hepatic mitochondrial damage in PCOS rats. (A)TEM examination of rat livers in the four groups. Scale bar: 500 nm. ▲, mitochondria; *, rough endoplasmic reticulum; ◻, autophagosome (n = 3).(B)Immunofluorescent staining showing TUNEL-stained cells in rat livers of the four groups. Scale bar: 20 μm (n = 3).
Citation: Endocrine Connections 13, 12; 10.1530/EC-24-0303
MT attenuated hepatic OS by inhibiting autophagy in PCOS
Autophagy is closely related to OS (21, 22). To investigate the effect of MT on autophagy and its role in regulating hepatic OS in PCOS, western blotting was conducted to measure the expression levels of autophagy. Compared to the control group, the DHEA group exhibited an increased level of autophagy in the liver. Additionally, the expression levels of Beclin1 and LC3 II were increased, while the expression level of P62 was decreased (Fig. 4A and B). TEM photographs of liver tissues also showed an increase in autophagosomes (Fig. 3A). However, the levels of autophagy were decreased in the DHEA + MT group (Fig. 4A and B). Consistent results were obtained from HepG2 cells in both the H2O2-exposed and H2O2 + MT groups (Fig. 4C). To further explore the relationship between autophagy and OS, we added the autophagy activator rapamycin to HepG2 cells co-treated with H2O2 + MT. The levels of autophagy and OS in HepG2 cells treated with rapamycin were higher than those in the H2O2 + MT group (Fig. 4C and D). Subsequently, the level of MDA was also higher in the supernatants of the H2O2 + MT + RAPA group than in the H2O2 + MT group. The ratio of GSSG/GSH was elevated in both the H2O2 and the H2O2 + MT + RAPA groups, whereas it was reduced in the H2O2 + MT group, indicating that the protective function of MT against OS was inhibited (Fig. 4E). These results showed that pretreatment with MT could inhibit autophagy to reduce OS in PCOS livers.
MT inhibited autophagy to reduce hepatic OS in PCOS. (A) Western blot analysis of Beclin1, P62, and LC3 expressions in rat livers of four groups (n = 3). (B) Immunofluorescent staining of P62 and LC3 in rat livers of four groups. Scale bar: 20 μm (n = 3). (C) Western blot analysis of Beclin1, P62, and LC3 expressions in HepG2 cells of five groups (n = 3).(D)Western blot analysis of HO-1, SOD1, and SOD2 expressions in HepG2 cells of five groups (n = 3).(E)Changes in the contents of MDA and antioxidant enzymes SOD, GSH-PX, and CAT in HepG2 cell supernatants of five groups. The GSSG/GSH ratio in HepG2 cells of five groups (n = 5). Data were presented as the mean ± s.d. *P < 0.05; **P < 0.01; #P < 0.05; ##P < 0.01.
Citation: Endocrine Connections 13, 12; 10.1530/EC-24-0303
MT alleviated hepatic OS by activating the Nrf2 pathway depended on the P62 autophagy pathway in PCOS
The Keap1–Nrf2 signaling pathway plays a critical role in the response to antioxidant stress regulated by the P62 autophagy pathway. To speculate whether MT affected the Nrf2 pathway by modulating the P62 autophagy pathway to ameliorate hepatic OS in PCOS, we examined the expression of cytoplasmic Keap1 and nuclear Nrf2. P62 and Nrf2 expression levels were lower, while Keap1 expression levels were higher in the DHEA group than in the control group. However, these changes were significantly reversed in the DHEA + MT group (Figs 4AB, 5A, B, D, andE). Similarly, the results from the cell experiments coincided with those from the animal experiments. After using ML385, a specific Nrf2 inhibitor, the expression of Keap1 was upregulated, while the expressions of Nrf2, HO-1, and SOD2 were downregulated in the H2O2 and H2O2 + ML385 groups. However, after using the specific Nrf2 activator TBHQ, the expression of Keap1 was downregulated, and the expressions of Nrf2, HO-1, and SOD2 were upregulated in the H2O2 + MT and H2O2 + TBHQ groups (Fig. 5C, F, G, H, I, and J). Moreover, the levels of MDA and the ratio of GSSG/GSH were increased in the H2O2 and H2O2 + ML385 groups, contrary to the results from the H2O2 + MT and H2O2 + TBHQ groups (Fig. 5K). These findings suggested that MT inhibited autophagy, thereby activating the Nrf2 signaling pathway to exert antioxidant effects.
MT regulated the Nrf2 pathway to attenuate hepatic OS via the P62 autophagy pathway in PCOS. (A) Immunohistochemistry analysis of Keap1 in rat livers of four groups. Scale bar: 50 μm (n = 3). (B)Western blot analysis of Keap1 expression in rat livers of four groups (n = 3).(C) Western blot analysis of Beclin1, P62, LC3, and Keap1 expressions in HepG2 cells of seven groups (n = 3). (D)Immunohistochemistry analysis of Nrf2 in rat livers of four groups. Scale bar: 50 μm (n = 3). (E) Western blot analysis of Nrf2 expression in rat livers of four groups (n = 3). (F) Western blot analysis of Nrf2 expression in HepG2 cells of seven groups (n = 3). (G)Western blot analysis of HO-1, SOD1, and SOD2 expressions in HepG2 cells of seven groups (n = 3). (H–J)Immunofluorescent staining of HO-1, SOD1, and SOD2 in HepG2 cells of seven groups. Scale bar: 20 μm (n = 3).(K)Changes in the contents of MDA and antioxidant enzymes SOD, GSH-PX, and CAT in HepG2 cell supernatants of seven groups. The GSSG/GSH ratio in HepG2 cells of seven groups (n = 5). Data were presented as the mean ± s.d. *P < 0.05; **P < 0.01; #P < 0.05; ##P < 0.01.
Citation: Endocrine Connections 13, 12; 10.1530/EC-24-0303
Discussion
MT serves as a natural antioxidant, capable of mitigating cellular oxidative damage by alleviating OS (23). Our research revealed that within the liver of PCOS rats, there was no statistically significant difference in MT1A mRNA levels, but MT still managed to replenish the MT1B levels that had been diminished by DHEA. Moreover, through in vivo experiments, we have validated that MT could assuage DHEA-induced OS and reduce TC, TG, ALT, and AST levels in the PCOS rat livers. Finally, in vitro experiments also elucidated that the antioxidant mechanism mediated by MT dependent on the regulation of the Keap1–Nrf2 pathway via autophagy.
As a cell signaling molecule, ROS are also regarded as toxic byproducts generated during aerobic metabolism (24). Research has shown that excess ROS can lead to OS, resulting in lipid peroxidation, protein distortion, and DNA breakage, ultimately harming hepatocytes (25). TEM results also showed hepatic abnormalities, such as ruptured mitochondrial membranes, blurred mitochondrial cristae, and twisted and fractured rough endoplasmic reticulum, in DHEA-induced PCOS rats. MDA is a natural byproduct of lipid peroxidation in organisms, and the antioxidant enzymes include SOD, CAT, GSH-PX, etc. Lipid peroxidation and decreased levels of antioxidant enzymes are accompanied by OS (26). The ratio between GSSG and GSH has been used as an important in vitro and in vivo biomarker of the redox balance in cell and, consequently, of cellular OS (27). Our study also indicated that the levels of OS were elevated in the serum of PCOS patients, as well as in the serum and livers of PCOS rats.
The liver is the primary organ tasked with overseeing metabolism and detoxification processes (28). Nonetheless, our current comprehension of the mechanisms that regulate OS within the liver of individuals affected by PCOS remains somewhat limited. In our research, we conducted a comparative analysis of the levels of OS and antioxidant stress indicators among various groups of model animals. The findings from our study emphatically revealed that MT effectively mitigated OS in the livers of PCOS rats. Moreover, it replenished the quantity and enhanced the structure of mitochondria within liver cells, thereby suggesting that MT could play a pivotal role in modulating OS in these cellular entities. Furthermore, Zhang et al. discovered that MT improved hepatic inflammation, OS, and mitochondrial autophagy after exposure to ochratoxin A (29). Reports have indicated that MT confers protection to the testes from palmitic acid-induced lipotoxicity through the activation of SIRT1, which alleviates OS (30). Despite these insights, the precise regulatory mechanisms through which MT exerts its influence on hepatic OS continue to be explored.
Autophagy regulates cell metabolism in response to environmental stimuli. However, excessive or insufficient autophagy can lead to diseases (31). Research on arsenic-induced hypertension suggested that MT may exert a protective effect against arsenic-induced vascular toxicity by suppressing apoptosis and modulating the Sirt1/autophagy pathway (32). Scientists have revealed that inhibiting autophagy could limit the cellular toxicity and OS induced by saturated fatty acids in hepatocytes (33). In this study, we observed increased expression of LC3 and Beclin1 in PCOS livers in vivo and in vitro and decreased expression of P62, which could be reversed by MT. Cell experiments further demonstrated a positive correlation between autophagy and OS. In summary, we believe that MT inhibits autophagy and ultimately suppresses hepatic OS in PCOS. However, there are currently no reports on how autophagy participates in the regulation of hepatic OS in PCOS.
P62 is a protein that binds to ubiquitin and serves as an autophagy receptor, connecting Nrf2 and the autophagy pathway (13, 34). The Keap1–Nrf2 pathway is the primary defense system in cells, safeguarding them from damage caused by OS (35). When P62 is phosphorylated or accumulates abnormally, it binds more strongly to Keap1, leading to the dissociation of Keap1 and Nrf2. As a result, Nrf2 moves to the nucleus and activates downstream regulatory pathways that shield cells from oxidative damage (21, 36). Research has also shown that knockout of Nrf2 reduces its transfer to the nucleus, thereby aggravating inflammation and autophagy. This process mainly depends on the P62–Keap1–Nrf2 signaling pathway, which is a well-known pathway involved in regulating autophagy in response to OS (37). Cheng et al. found that MT elicited Nrf2 by disrupting the interaction between Keap1 and Nrf2 to promote antioxidant enzyme expression such as HO-1, which would salvage HCPT-induced ROS production (38). In acute pancreatitis models, the antioxidant sitagliptin inhibits inflammation and ameliorates OS by activating the P62–Keap1–Nrf2 pathway, protecting pancreatic function (39). Our study found that the expression of P62 was significantly decreased in the livers of PCOS rats and in HepG2 cells exposed to H2O2. Using Nrf2 inhibitors, we demonstrated that inhibiting the Keap1/Nrf2 signaling pathway worsens OS in hepatocytes. Overall, these findings further support that MT improves hepatic OS levels by activating the Keap1–Nrf2 signaling pathway, which is regulated by P62 autophagy.
Mechanisms for improving OS in a damaged liver by antioxidants have been extensively reported (40). These studies have investigated various factors, including autophagy, inflammation, and small RNA regulation (41). However, none of these studies have explored the involvement of MT in regulating hepatic OS in PCOS. Therefore, it is necessary to further elucidate the regulatory mechanisms by which MT affects OS in animal models. In brief, our research first demonstrated that MT plays a protective role in DHEA-induced hepatic OS in PCOS through the P62–Keap1–Nrf2 pathway.
In summary, our study indicated that MT could inhibit autophagy by activating the Keap1–Nrf2 signaling pathway, resulting in reduced hepatic OS in PCOS.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
The present work was funded by the National Natural Science Foundation Youth Project of China (82101716, 82201804), the Doctoral Research Fund of Anhui Medical University (XJ202002), the Open Project of Anhui Province Key Laboratory of Reproductive Health and Genetics (RHG-2020-8), the Research Fund of Anhui Institute of Translational Medicine (ZHYX2020A001), the National Innovation and Entrepreneurship Training Program for College Students (202310366030), and the Provincial College Students Innovation and Entrepreneurship Training Program (S202210366059, S202310366002X).
Data availability statement
Raw data and modeling scripts are available on request.
Author contributions statement
FFX, designed this work; FFX and QH, editing of the study; YJL, technical and material support; JHZ, conducted the in vivo experiments; HYZ and BG, performed the in vitro experiments; JY, RXY, and MXZ, collected the samples; WXC and YHC, analyzed the data; JHZ, HYZ, BG, and JY, writing the first draft of the manuscript. All the authors have read and approved the final manuscript.
Acknowledgements
The authors are grateful to Professor Li-Jie Feng at Anhui Medical University for kindly supplying HepG2 cells for the research.
References
- 1↑
Dapas M, & Dunaif A. Deconstructing a syndrome: genomic insights into PCOS causal mechanisms and classification. Endocrine Reviews 2022 43 927–965. (https://doi.org/10.1210/endrev/bnac001)
- 2↑
Zhu T, & Goodarzi MO. Causes and consequences of polycystic ovary syndrome: insights from Mendelian randomization. Journal of Clinical Endocrinology and Metabolism 2022 107 e899–e911. (https://doi.org/10.1210/clinem/dgab757)
- 3↑
Li R, Li Z, Huang Y, Hu K, Ma B, & Yang Y. The effect of magnesium alone or its combination with other supplements on the markers of inflammation, OS and metabolism in women with polycystic ovarian syndrome (PCOS): a systematic review. Frontiers in Endocrinology 2022 13 974042. (https://doi.org/10.3389/fendo.2022.974042)
- 4↑
Longo M, Zatterale F, Naderi J, Parrillo L, Formisano P, Raciti GA, Beguinot F, & Miele C. Adipose tissue dysfunction as determinant of obesity-associated metabolic complications. International Journal of Molecular Sciences 2019 20. (https://doi.org/10.3390/ijms20092358)
- 5↑
Loomba R, Friedman SL, & Shulman GI. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell 2021 184 2537–2564. (https://doi.org/10.1016/j.cell.2021.04.015)
- 6↑
Doycheva I, & Ehrmann DA. Nonalcoholic fatty liver disease and obstructive sleep apnea in women with polycystic ovary syndrome. Fertility and Sterility 2022 117 897–911. (https://doi.org/10.1016/j.fertnstert.2022.03.020)
- 7↑
Mizushima N, & Levine B. Autophagy in human diseases. New England Journal of Medicine 2020 383 1564–1576. (https://doi.org/10.1056/NEJMra2022774)
- 8↑
Chen W, Hu Z, Yu M, Zhu S, Xing J, Song L, Pu W, & Yu F. A molecular link between autophagy and circadian rhythm in plants. Journal of Integrative Plant Biology 2022 64 1044–1058. (https://doi.org/10.1111/jipb.13250)
- 9↑
Chao X, Qian H, Wang S, Fulte S, & Ding WX. Autophagy and liver cancer. Clinical and Molecular Hepatology 2020 26 606–617. (https://doi.org/10.3350/cmh.2020.0169)
- 10↑
Gao J, Wei B, de Assuncao TM, Liu Z, Hu X, Ibrahim S, Cooper SA, Cao S, Shah VH, & Kostallari E. Hepatic stellate cell autophagy inhibits extracellular vesicle release to attenuate liver fibrosis. Journal of Hepatology 2020 73 1144–1154. (https://doi.org/10.1016/j.jhep.2020.04.044)
- 11↑
Qian H, Chao X, Williams J, Fulte S, Li T, Yang L, & Ding WX. Autophagy in liver diseases: a review. Molecular Aspects of Medicine 2021 82 100973. (https://doi.org/10.1016/j.mam.2021.100973)
- 12↑
Rajak S, Raza S, & Sinha RA. ULK1 signaling in the liver: autophagy dependent and independent actions. Frontiers in Cell and Developmental Biology 2022 10 836021. (https://doi.org/10.3389/fcell.2022.836021)
- 13↑
Lee DH, Park JS, Lee YS, Han J, Lee DK, Kwon SW, Han DH, Lee YH, & Bae SH. SQSTM1/p62 activates NFE2L2/NRF2 via ULK1-mediated autophagic KEAP1 degradation and protects mouse liver from lipotoxicity. Autophagy 2020 16 1949–1973. (https://doi.org/10.1080/15548627.2020.1712108)
- 14↑
Wang X, Wang Z, Cao J, Dong Y, & Chen Y. Gut microbiota-derived metabolites mediate the neuroprotective effect of melatonin in cognitive impairment induced by sleep deprivation. Microbiome 2023 11 17. (https://doi.org/10.1186/s40168-022-01452-3)
- 15↑
Xie F, Zhang J, Zhai M, Liu Y, Hu H, Yu Z, Zhang J, Lin S, Liang D, & Cao Y. Melatonin ameliorates ovarian dysfunction by regulating autophagy in PCOS via the PI3K-Akt pathway. Reproduction 2021 162 73–82. (https://doi.org/10.1530/REP-20-0643)
- 16↑
Sato K, Meng F, Francis H, Wu N, Chen L, Kennedy L, Zhou T, Franchitto A, Onori P, Gaudio E, et al. Melatonin and circadian rhythms in liver diseases: functional roles and potential therapies. Journal of Pineal Research 2020 68 e12639. (https://doi.org/10.1111/jpi.12639)
- 17↑
Bonomini F, Borsani E, Favero G, Rodella LF, & Rezzani R. Dietary melatonin supplementation could be a promising preventing/therapeutic approach for a variety of liver diseases. Nutrients 2018 10. (https://doi.org/10.3390/nu10091135)
- 18↑
Das N, Mandala A, Naaz S, Giri S, Jain M, Bandyopadhyay D, Reiter RJ, & Roy SS. Melatonin protects against lipid-induced mitochondrial dysfunction in hepatocytes and inhibits stellate cell activation during hepatic fibrosis in mice. Journal of Pineal Research 2017 62. (https://doi.org/10.1111/jpi.12404)
- 19↑
de Luxan-Delgado B, Potes Y, Rubio-Gonzalez A, Caballero B, Solano JJ, Fernandez-Fernandez M, Bermudez M, Rodrigues MGM, Vega-Naredo I, Boga JA, et al. Melatonin reduces endoplasmic reticulum stress and autophagy in liver of leptin-deficient mice. Journal of Pineal Research 2016 61 108–123. (https://doi.org/10.1111/jpi.12333)
- 20↑
Zhou H, Du W, Li Y, Shi C, Hu N, Ma S, Wang W, & Ren J. Effects of melatonin on fatty liver disease: the role of NR4a1/DNA-PKcs/p53 pathway, mitochondrial fission, and mitophagy. Journal of Pineal Research 2018 64. (https://doi.org/10.1111/jpi.12450)
- 21↑
Filomeni G, De Zio D, & Cecconi F. Oxidative stress and autophagy: the clash between damage and metabolic needs. Cell Death and Differentiation 2015 22 377–388. (https://doi.org/10.1038/cdd.2014.150)
- 22↑
Deng Z, Lim J, Wang Q, Purtell K, Wu S, Palomo GM, Tan H, Manfredi G, Zhao Y, Peng J, et al. ALS-FTLD-linked mutations of SQSTM1/p62 disrupt selective autophagy and NFE2L2/NRF2 anti-oxidative stress pathway. Autophagy 2020 16 917–931. (https://doi.org/10.1080/15548627.2019.1644076)
- 23↑
Chitimus DM, Popescu MR, Voiculescu SE, Panaitescu AM, Pavel B, Zagrean L, & Zagrean AM. Melatonin's impact on antioxidative and anti-inflammatory reprogramming in homeostasis and disease. Biomolecules 2020 10. (https://doi.org/10.3390/biom10091211)
- 24↑
Quan N, Li X, Zhang J, Han Y, Sun W, Ren D, Tong Q, & Li J. Substrate metabolism regulated by Sestrin2-mTORC1 alleviates pressure overload-induced cardiac hypertrophy in aged heart. Redox Biology 2020 36 101637. (https://doi.org/10.1016/j.redox.2020.101637)
- 25↑
Chen Z, Tian R, She Z, Cai J, & Li H. Role of oxidative stress in the pathogenesis of nonalcoholic fatty liver disease. Free Radical Biology and Medicine 2020 152 116–141. (https://doi.org/10.1016/j.freeradbiomed.2020.02.025)
- 26↑
Ma L, Wu F, Shao Q, Chen G, Xu L, & Lu F. Baicalin alleviates oxidative stress and inflammation in diabetic nephropathy via Nrf2 and MAPK signaling pathway. Drug Design, Development and Therapy 2021 15 3207–3221. (https://doi.org/10.2147/DDDT.S319260)
- 27↑
Chen TH, Wang HC, Chang CJ, & Lee SY. Mitochondrial glutathione in cellular redox homeostasis and disease manifestation. International Journal of Molecular Sciences 2024 25. (https://doi.org/10.3390/ijms25021314)
- 28↑
Reinke H, & Asher G. Circadian clock control of liver metabolic functions. Gastroenterology 2016 150 574–580. (https://doi.org/10.1053/j.gastro.2015.11.043)
- 29↑
Zhang H, Yan A, Liu X, Ma Y, Zhao F, Wang M, Loor JJ, & Wang H. Melatonin ameliorates ochratoxin A induced liver inflammation, oxidative stress and mitophagy in mice involving in intestinal microbiota and restoring the intestinal barrier function. Journal of Hazardous Materials 2021 407 124489. (https://doi.org/10.1016/j.jhazmat.2020.124489)
- 30↑
Xu D, Liu L, Zhao Y, Yang L, Cheng J, Hua R, Zhang Z, & Li Q. Melatonin protects mouse testes from palmitic acid-induced lipotoxicity by attenuating oxidative stress and DNA damage in a SIRT1-dependent manner. Journal of Pineal Research 2020 69 e12690. (https://doi.org/10.1111/jpi.12690)
- 31↑
Levine B, & Kroemer G. Biological functions of autophagy genes: a disease perspective. Cell 2019 176 11–42. (https://doi.org/10.1016/j.cell.2018.09.048)
- 32↑
Balarastaghi S, Barangi S, Hosseinzadeh H, Imenshahidi M, Moosavi Z, Razavi BM, & Karimi G. Melatonin improves arsenic-induced hypertension through the inactivation of the Sirt1/autophagy pathway in rat. Biomedicine and Pharmacotherapy 2022 151 113135. (https://doi.org/10.1016/j.biopha.2022.113135)
- 33↑
Veskovic M, Mladenovic D, Milenkovic M, Tosic J, Borozan S, Gopcevic K, Labudovic-Borovic M, Dragutinovic V, Vucevic D, Jorgacevic B, et al. Betaine modulates oxidative stress, inflammation, apoptosis, autophagy, and Akt/mTOR signaling in methionine-choline deficiency-induced fatty liver disease. European Journal of Pharmacology 2019 848 39–48. (https://doi.org/10.1016/j.ejphar.2019.01.043)
- 34↑
Xu B, He T, Yang H, Dai W, Liu L, Ma X, Ma J, Yang G, Si R, Du X, et al. Activation of the p62-Keap1-Nrf2 pathway protects against oxidative stress and excessive autophagy in ovarian granulosa cells to attenuate DEHP-induced ovarian impairment in mice. Ecotoxicology and Environmental Safety 2023 265 115534. (https://doi.org/10.1016/j.ecoenv.2023.115534)
- 35
Yao H, He Q, Huang C, Wei S, Gong Y, Li X, Liu W, Xu Z, Wu H, Zheng C, et al. Panaxatriol saponin ameliorates myocardial infarction-induced cardiac fibrosis by targeting Keap1/Nrf2 to regulate oxidative stress and inhibit cardiac-fibroblast activation and proliferation. Free Radical Biology and Medicine 2022 190 264–275. (https://doi.org/10.1016/j.freeradbiomed.2022.08.016)
- 36↑
Mizunoe Y, Kobayashi M, Sudo Y, Watanabe S, Yasukawa H, Natori D, Hoshino A, Negishi A, Okita N, Komatsu M, et al. Trehalose protects against oxidative stress by regulating the Keap1-Nrf2 and autophagy pathways. Redox Biology 2018 15 115–124. (https://doi.org/10.1016/j.redox.2017.09.007)
- 37↑
Zhang Y, Liu M, Zhang Y, Tian M, Chen P, Lan Y, & Zhou B. Urolithin a alleviates acute kidney injury induced by renal ischemia reperfusion through the p62-Keap1-Nrf2 signaling pathway. Phytotherapy Research 2022 36 984–995. (https://doi.org/10.1002/ptr.7370)
- 38↑
Cheng J, Xu J, Gu Y, Wang Y, Wang J, & Sun F. Melatonin ameliorates 10-hydroxycamptothecin-induced oxidative stress and apoptosis via autophagy-regulated p62/Keap1/Nrf2 pathway in mouse testicular cells. Journal of Pineal Research 2024 76 e12959. (https://doi.org/10.1111/jpi.12959)
- 39↑
Kong L, Deng J, Zhou X, Cai B, Zhang B, Chen X, Chen Z, & Wang W. Sitagliptin activates the p62-Keap1-Nrf2 signalling pathway to alleviate oxidative stress and excessive autophagy in severe acute pancreatitis-related acute lung injury. Cell Death and Disease 2021 12 928. (https://doi.org/10.1038/s41419-021-04227-0)
- 40↑
Lee SE, Koh H, Joo DJ, Nedumaran B, Jeon HJ, Park CS, Harris RA, & Kim YD. Induction of SIRT1 by melatonin improves alcohol-mediated oxidative liver injury by disrupting the CRBN-YY1-CYP2E1 signaling pathway. Journal of Pineal Research 2020 68 e12638. (https://doi.org/10.1111/jpi.12638)
- 41↑
Wahlen E, Olsson F, Soderberg O, Lennartsson J, & Heldin J. Differential impact of lipid raft depletion on platelet-derived growth factor (PDGF)-induced ERK1/2 MAP-kinase, SRC and AKT signaling. Cellular Signalling 2022 96 110356. (https://doi.org/10.1016/j.cellsig.2022.110356)
