Abstract
The link between obesity and low bone strength has become a significant medical concern. The canonical Wnt signaling pathway is a key regulator of mesenchymal stem cell differentiation into either osteoblasts or adipocytes with active Wnt signaling promoting osteoblastogenesis. Our previous research indicated that Dickkopf-1 (Dkk1), a Wnt inhibitor, is upregulated in bone tissue in obesity and that osteoblast-derived Dkk1 drives obesity-induced bone loss. However, Dkk1 is also produced by adipocytes, but the impact of adipogenic Dkk1 on bone remodeling and its role in obesity-induced bone loss remain unclear. Thus, in this study, we investigated the influence of adipogenic Dkk1 on bone homeostasis and obesity-induced bone loss in mice. To that end, deletion of Dkk1 in adipocytes was induced by tamoxifen administration into 8-week-old male Dkk1fl/fl;AdipoQcreERT2 mice. Bone and fat mass were analyzed at 12 and 20 weeks of age. Obesity was induced in 8-week-old male Dkk1fl/fl;AdipoQcre mice with a high-fat diet (HFD) rich in saturated fats for 12 weeks. We observed that 12-week-old male mice without adipogenic Dkk1 had a significant increase in trabecular bone volume in the vertebrae and femoral bones. While histological and serological bone formation markers were not different, the number of osteoclasts and adipocytes was decreased in the vertebral bones of Dkk1fl/fl;AdipoQcre-positive mice. Despite the increased bone mass in 12-week-old male mice, at 20 weeks of age, there was no difference in the bone volume between the controls and Dkk1fl/fl;AdipoQcre-positive mice. Also, Dkk1fl/fl;AdipoQcre-positive mice were not protected from HFD-induced bone loss. Even though mRNA expression levels of Sost, another important Wnt inhibitor, in bone from Dkk1-deficient mice fed with HFD were decreased compared to Dkk1-sufficient mice on an HFD, this did not prevent the HFD-induced suppression of bone formation. In conclusion, adipogenic Dkk1 may play a transient role in bone mass regulation during adolescence, but it does not contribute to bone homeostasis or obesity-induced bone loss later in life.
Introduction
Osteoporosis is a major health burden worldwide, causing 8.9 million fractures per year (1). The increased risk of fractures primarily affects older people (2) and postmenopausal women (3) and is often associated with poor dietary habits, excess caloric intake, and low physical activity (4, 5). Although new technologies and medical advances have improved life expectancy over the years, reduced quality of life paradoxically persists in the aging population, driven mostly by chronic conditions and their associated complications (6). Also the health of younger age groups is challenged by a more sedentary lifestyle and frequent consumption of high-fat diets (HFDs) leading to obesity (7, 8). To date, over 1 billion people are reported to be obese (9).
It is well established that overweight patients have a higher risk of bone fractures compared to healthy individuals (10, 11). Previous research has highlighted the significant role of the Wnt pathway in bone remodeling and repair (12, 13). Dickkopf-1 (Dkk1), in particular, a well-known inhibitor of Wnt signaling, has been shown to be overexpressed in several metabolic disorders, including obesity (14, 15) and osteoporosis (16, 17), which can negatively impact bone health. Dkk1 inhibits bone formation and stimulates bone resorption via increasing the receptor activator of nuclear factor-κB-ligand (RANKL)/osteoprotegerin (OPG) ratio in osteogenic cells (18, 19). Our recent study in male mice lacking Dkk1 in osteogenic cells has shown that these mice were protected from HFD-induced cortical bone loss compared to control mice (20). This was mediated mostly by a smaller increase in osteoclast numbers in mice lacking DKK1 in osteogenic cells after HFD than wild-type mice on an HFD. It is noteworthy that adipocytes also have been reported to express DKK1 (21, 22). Moreover, treatment of pre-adipocytes with Dkk1 suppresses their differentiation in cell cultures (23). Given that obesity is characterized by an expansion of adipose tissue with potentially high Dkk1 expression (15), we hypothesized that Dkk1 produced by adipocytes could play a key role in HFD-induced bone loss. Therefore, our primary objective was to assess the impact of adipogenic Dkk1 on bone homeostasis in male mice and, secondly, to investigate its role in a mouse model of HFD-induced bone loss.
Our findings demonstrate that 12-week-old male mice with Dkk1 deficiency in adipocytes exhibited higher bone mass, which was not maintained at 20 weeks of age. Furthermore, our results indicate that adipogenic Dkk1 does not contribute to HFD-induced bone loss.
Methods
Animal model and high-fat diet
Floxed Dkk1 mice (Dkk1fl/fl) (24) in which exons 1 and 2 are flanked by loxP sites were crossed with C57BL/6-Tg(Adipoq-cre/ERT2)1Soff/J mice (Jax mice, strain No. 025124) to generate mice with tamoxifen-inducible Dkk1 deletion in adipocytes (here referred to as Dkk1fl/fl;AdipoQcre) (25, 26). At the age of 5 weeks, male Dkk1fl/fl;AdipoQcre-positive and -negative control mice were injected i.p. with 100 µL tamoxifen (10 g/L; Sigma, Merck KGaA, Darmstadt, Germany) for five consecutive days to induce specific adipogenic deletion of Dkk1. All mice were housed in groups of four animals per cage in an air-conditioned room at 23°C and subjected to a 12-hlight/darkness cycle. Male mice were sacrificed at 10–12 weeks of age for assessing the bone phenotype.
To induce obesity, Dkk1 was first deleted in 5-week-old male mice. At 8 weeks of age, Dkk1fl/fl;AdipoQ-Cre-positive and -negative mice were exposed to an HFD with 60% fat, 20% carbohydrate, and 20% protein (Research Diets #12492, Research Diets, Inc., New Brunswick, NJ, USA) for 12 weeks. The control groups of both genotypes received a normal diet (ND: 9% fat, 58% carbohydrate, and 33% protein (Ssniff #V1534-300, Research Diets, Inc., New Brunswick, NJ, USA). Mice were assigned to diet groups at random, and subsequent analyses were performed blindly. To avoid the influence of sex hormones, male mice were used. Body weight and blood glucose levels were assessed at week 5, 8, 12, 18, and 20. The institutional animal care committee of the TU Dresden and the Landesdirektion Sachsen approved all animal procedures.
Glucose and insulin tolerance tests
The glucose tolerance test (GTT) was evaluated after overnight fasting by measuring blood glucose levels after 15, 30, 60, 90, and 180 min after administering 2g/L glucose i.p. using a glucometer (ACCU CHEK Aviva III; Roche Diabetes Care, Mannheim, Germany). For the insulin tolerance test (ITT), mice were fasted for 4 h. After i.p. injection of 0.75 IU insulin (Lilly, Bad Homburg vor der Höhe, Germany), glucose clearance in the blood was evaluated by measuring blood glucose levels after 15, 30, 60, 90, and 180 min.
Bone turnover markers
After blood collection via heart puncture, serum was centrifuged for 10 min at 400 g . Serological analysis of bone turnover markers procollagen type 1 amino-terminal-propeptide (P1NP), C-terminal telopeptide of type I collagen (CTX) and tartrate-resistant acid phosphatase 5b (TRAcP 5b) were measured using commercially available ELISA kits from IDS (Frankfurt/Main, Germany). Dkk1 was measured using an ELISA kit from R&D Systems.
Micro-computed tomography analysis of bone
The bone mass and microarchitecture of the distal femur and fourth lumbar vertebra (L4) were evaluated using micro-computed tomography (microCT) with a vivaCT 40 scanner (Scanco Medical, Brüttisellen, Switzerland). Bones were scanned ex vivo using an energy of 70 kVp and a resolution of 10.5 µm isotropic voxel size (114 mA, integration time 200 ms). One hundred slices of the distal femur and the mid-vertebra were analyzed using Scanco Medical standard protocols to assess trabecular bone parameters such as bone volume/total volume (BV/TV), trabecular number (Tb.N), trabecular separation (Tb.Sp), and trabecular thickness (Tb.Th). Cortical bone parameters such as cortical thickness (Ct.Th) and cortical bone mineral density (Ct.BMD) were determined at the femoral midshaft, where also 100 slices were analyzed. The results were reported in accordance with the guidelines of the American Society for Bone and Mineral Research (27).
Bone histology and histomorphometry
Prior to the microCT measurements, the L4 vertebrae were fixed in 4% PBS-buffered paraformaldehyde (PFA) for 48 h. After microCT measurements, bones were decalcified using Osteosoft (Merck) for 7 days. The bones were dehydrated using a series of ascending ethanol concentrations and embedded in paraffin. Two-micrometer thick sections were cut from the decalcified bones, and tartrate-resistant acid phosphatase (TRAP) staining was performed to quantify the number of osteoblasts per bone perimeter (N.Ob/B.Pm), the number of osteoclasts per bone perimeter (N.Oc/B.Pm), and the number of adipocytes per bone perimeter (N.Ad/B.Pm) in the center of the vertebrae.
Histomorphometric analysis of calcein double labeling on undecalcified samples was also conducted to determine the mineralizing surface/bone surface (MS/BS), mineral apposition rate (MAR), and bone formation/bone surface (BFR/BS). To that end, calcein was injected at 20 mg/kg on day 5 and day 2 before sacrifice. After fixation for 48 h in 4% PFA/PBS, 7-µm thick sections were made. The Microscope Axio Imager M1 (Carl Zeiss) and Osteomeasure software (OsteoMetrics, Atlanta, GA, USA) were used for quantification of the fluorescent labels in accordance with the guidelines of the Nomenclature Committee of the ASBMR (27).
RNA extraction, cDNA synthesis, and quantitative real-time PCR
Total RNA was extracted from femoral bone tissue and subcutaneous and gonadal fat using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions and quantified using a Nanodrop ND-1000 spectrophotometer (Thermo Scientific/PEQLAB). Bones were collected post mortem and flushed with PBS before RNA extraction. Five hundred nanograms of RNA were reverse transcribed using Superscript (Invitrogen) followed by SYBR Green-based quantitative real-time PCR. The primer sequences for amplification were β-actin (sense: GATCTGGCACCACACCTTCT, antisense: GGGGTGTTGAAGGTCTCAAA), Dkk1 (sense: GCCTCCGATCATCAGACGGT, antisense: GCAGGTGTGGAGCCTAGAAG), Sost (sense: CGTGCCTCATCTGCCTACTT, antisense: TGACCTCTGTGGCATCATTC), Rankl (sense: CCGAGACTACGGCAAGTACC, antisense: GCGCTCGAAAGTACAGGAAC), and Opg (sense: CCTTGCCCTGACCACTCTTA, antisense: ACACTGGGCTGCAATACACA). The PCR cycling conditions were as follows: 50°C for 5 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Melting curves were evaluated using the following scheme: 95°C for 15 s, 60°C for 1 min, and 95°C for 30 s. The results were calculated based on the ∆∆CT method and are presented as a fold change normalized to the β-actin level.
Statistical analysis
Data are shown as mean ± standard deviation (s.d.). A two-sided unpaired Student’s t-test was used to perform statistical analysis for the comparison of two groups (Cre-negative and Cre-positive) in the steady-state experiment. For the in vivo HFD-induced obesity experiment with more than two groups, a two-way ANOVA was conducted, followed by Bonferroni’s multiple comparison test to determine the statistical significance. A P-value < 0.05 was considered statistically significant.
Results
Dkk1fl/fl;AdipoQcre mice show reduced Dkk1 expression in subcutaneous fat and in the blood
To investigate whether adipogenic Dkk1 plays a role in bone homeostasis, we generated Dkk1fl/fl;AdipoQcre mice which specifically target adipocytes (28, 29). At 12 weeks of age, male Dkk1fl/fl;AdipoQcre mice showed a similar body weight (Fig. 1A), but a 49% decrease in subcutaneous fat pad weight compared to Cre-negative littermate controls (Fig. 1B) while gonadal fat showed no significant differences (Fig. 1C). To examine the knock-down efficiency of Dkk1 in fat tissue, we analyzed Dkk1 mRNA levels in subcutaneous and gonadal fat and determined Dkk1 protein levels in the serum. Dkk1fl/fl;AdipoQcre-positive mice showed lower levels of Dkk1 in subcutaneous fat (−57%, Fig. 1D) and in the serum (−27%, Fig. 1E) compared with littermate controls.
Male Dkk1fl/fl;AdipoQcre mice show decreased Dkk1 expression in subcutaneous fat and serum levels. At the end of the experiment, (A) body weight, (B) subcutaneous, and (C) gonadal fat pads from 12-week-old male Dkk1;AdipoQcre (Cre-negative and Cre-positive) mice were assessed. (D) Dickkopf-1 (Dkk1) gene expression from subcutaneous fat was determined by real-time PCR. (E) Serum Dkk1 level were measured using commercially available ELISA. Data represent the mean ± s.d. N = 6–8 per group. Statistical analysis was performed by the Student’s t-test. Statistical significance is shown in the graphs. *P < 0.05; ***P < 0.001.
Citation: Endocrine Connections 12, 11; 10.1530/EC-23-0251
Deletion of adipogenic Dkk1 enhances bone mass
We next examined the bone phenotype of Dkk1fl/fl;AdipoQcre mice using microCT analysis. Bone volume of 12-week-old male mice lacking adipogenic Dkk1 was significantly increased in the fourth lumbar vertebrae (L4, +42%) and distal femur (+58%) (Fig. 2A and E). There were no significant changes in the Tb.N (Fig. 2B and F) and Tb.Sp (Fig. 2D and H) in vertebrae and femur. However, Dkk1fl/fl;AdipoQcre-positive mice had a higher Tb.Th in vertebrae (+12%) but not in the femur (Fig. 2C and G). Cortical parameters in the femoral mid-shaft including bone mineral density and thickness were unaltered between the genotypes (Fig. 2I and J).
Male Dkk1fl/fl;AdipoQcre mice show increased bone volume. Bones of 12-week-old male Dkk1;AdipoQcre (Cre-negative and Cre-positive) mice were analyzed by microCT. (A) Bone volume per total volume (BV/TV), (B) trabecular number (Tb.N), (C) trabecular thickness (Tb.Th), and (D) trabecular separation (Tb.Sp) of the fourth vertebral body. Additionally, (E) BV/TV, (F) Tb.N, (G) Tb.Th, and (H) Tb.Sp at the distal femur. (I) cortical thickness (Ct.Th) and (J) cortical bone mineral density (Ct.BMD) analyzed on the femoral diaphysis. Data represent the mean ± s.d.N = 6–10 per group. Statistical analysis was performed by the Student’s t-test. Statistical significance is shown in the graphs. *P < 0.05.
Citation: Endocrine Connections 12, 11; 10.1530/EC-23-0251
Deletion of adipogenic Dkk1 has no effect on bone formation but reduces osteoclast and adipocyte numbers
We next assessed whether the high bone mass is derived from enhanced bone formation or reduced bone resorption. Regarding bone formation, Dkk1fl/fl;AdipoQcre-positive mice showed no significant differences between the serum bone formation marker P1NP (Fig. 3A) or the number of osteoblasts and the bone formation rate at the L4 compared to their control littermates (Fig. 3B and C). While serum levels of the bone resorption marker CTX were not altered (Fig. 3D), a significant decrease of serum TRAcP 5b (Fig. 3E) and a significant reduction of osteoclast (−54%) and adipocyte numbers (−76%) in the vertebral bone of Dkk1fl/fl;AdipoQcre-positive mice was observed compared with their wild-type controls (Fig. 3F and G).
Adipocyte-specific Dkk1 deletion had no effect on bone formation and resorption but showed a reduction in the number of vertebral osteoclasts and adipocytes. Serum samples and vertebrae from 12-week-old Dkk1;AdipoQcre (Cre-negative and Cre-positive) mice were used for quantification of bone turnover makers and histological evaluation. Serum level of (A) bone formation marker type 1 procollagen amino-terminal-propeptide (P1NP) was measured using ELISA. (B) Osteoblast number per bone perimeter (N.Ob/B.Pm) was measured by TRAP-stained sections of vertebra. (C) The bone formation rate/bone surface (BFR/BS) was determined by histomorphometric analysis of calcein double staining. (D) Bone resorption marker C-terminal telopeptide (CTX) and (E) tartrate-resistant acid phosphatase 5b (TRAcP 5b) were measured using ELISA. (F) Osteoclast number per bone perimeter (N.Oc/B.Pm) and (G) adipocyte number per bone perimeter (N.Ad/B.Pm) in spine. Data represent the mean ± s.d. N = 7–10 per group. Statistical analysis was performed by the Student’s t-test. Statistical significance is shown in the graphs. *P < 0.05, **P < 0.01.
Citation: Endocrine Connections 12, 11; 10.1530/EC-23-0251
HFD induces obesity regardless of adipogenic Dkk1 expression
As mice lacking Dkk1 in adipocytes showed a mild increase in bone mass, and adipose tissue expands in obesity, we reasoned that the importance of adipose-derived Dkk1 may become more important during this pathological condition. Thus, we assessed the contribution of adipogenic Dkk1 to the pathogenesis of obesity-induced bone loss. To that end, we exposed 8-week-old male Dkk1fl/fl;AdipoQcre-positive and -negative mice to an HFD for 12 weeks. Dkk1fl/fl;AdipoQcre-positive and their Cre-negative littermates mice gained a similar amount of body weight when fed an HFD (66% and 57%, respectively) or an ND (Fig. 4A). This was accompanied by a notable and significant increase in the proportion of their subcutaneous (three-fold) (Fig. 4B) and gonadal fat mass compared to mice fed an ND (2.5- to 3-fold) (Fig. 4C). Moreover, the HFD impaired the glucose and insulin tolerance in both genotypes to a similar extent (Fig. 4D and E). In contrast to the 12-week-old cohort without HFD, Dkk1 mRNA expression was unchanged in gonadal fat pads and in the serum of Dkk1fl/fl;AdipoQcre-positive mice (Fig. 4F and G).
Mice lacking Dkk1 in adipocytes show similar signs of obesity. Male Dkk1;AdipoQcre (Cre-negative and Cre-positive) were fed a standard (ND) or high-fat diet (HFD) for 12 weeks. Then, (A) body weight was measured, percentage of body (B) subcutaneous and (C) gonadal fat pads were quantified. (D) A glucose tolerance test (GTT) and (E) insulin tolerance test (ITT) from 20-week-old male Dkk1;AdipoQcre (Cre-negative and Cre-positive) was carried out. (F) Dickkopf-1 (Dkk1) gene expression from gonadal fat was determined by real-time PCR. (G) Serum Dkk1 level were measured using commercially available ELISA. Data represent the mean ± s.d. N = 3–6 per group. Statistical analysis was performed by two-way ANOVA. Statistical significance is shown in the graphs. *** P < 0.0001.
Citation: Endocrine Connections 12, 11; 10.1530/EC-23-0251
Adipogenic-Dkk1 deletion does not protect against obesity-induced bone loss
We next investigated whether Dkk1fl/fl;AdipoQcre-positive mice were protected from HFD-induced bone loss. However, no differences were observed between the two genotypes. In contrast to 12-week-old male mice, trabecular bone parameters at the L4 (Fig. 5A, B, C, and D) and distal femur (Fig. 5E, F, and G) of 20-week-old male Dkk1fl/fl;AdipoQcre-positive mice on an ND were not different from wild-type littermates. Moreover, Dkk1fl/fl;AdipoQcre-positive mice were not protected from HFD-induced bone loss at the femur as indicated by the bone volume and the trabecular bone parameters (Fig. 5E, F, and G). Interestingly, no bone loss was observed at the L4 vertebrae in either genotype (Fig. 5A, B, C, and D). In addition, a significant decrease in femoral Ct.Th was noted for Dkk1fl/fl;AdipoQcre-positive mice under HFD compared to mice on an ND (Fig. 5I). This difference was not observed in their control littermates. Furthermore, femoral Ct.BMD was significantly lower in Dkk1fl/fl;AdipoQcre-positive compared to their Cre-negative group on an HFD (−2%), even though overall, the differences were marginal (Fig. 5J).
Deletion of adipogenic Dkk1 does not protect against obesity-induced bone loss. Bones of 20-week-old male Dkk1;AdipoQcre (Cre-negative and Cre-positive) mice after 12 weeks of normal (ND) or high-fat diet (HFD) were analyzed by microCT. (A) Bone volume per total volume (BV/TV), (B) trabecular number (Tb.N), (C) trabecular thickness (Tb.Th), and (D) trabecular separation (Tb.Sp) of the fourth vertebral body. Additionally, (E) BV/TV, (F) Tb.N, (G) Tb.Th, and (H) Tb.Sp at the distal femur, as well as (I) cortical thickness (Ct.Th) and (J) cortical bone mineral density (Ct.BMD) analyzed on the femoral diaphysis. Data represent the mean ± s.d. N = 5–7 per group. Statistical analysis was performed by two-way ANOVA. Statistical significance is shown in the graphs. *P < 0.05, **P < 0.01, ***P < 0.001.
Citation: Endocrine Connections 12, 11; 10.1530/EC-23-0251
Adipogenic Dkk1 conditional knockout does not prevent HFD-induced suppression of bone formation
Finally, a serological evaluation was performed to verify whether bone turnover markers were differentially regulated in Dkk1;AdipoQ-cre mice on the HFD. P1NP serum levels were significantly decreased after HFD in both genotypes (48% and 56%, respectively) (Fig. 6A). Likewise, tibial mineralization surface per bone surface was significantly decreased in both genotypes (48% and 49%, respectively) (Fig. 6B), while mineral apposition rate and bone formation rate showed no significant changes in HFD mice (Fig. 6C and D). Moreover, CTX serum levels were not significantly different after HFD between wild type and Dkk1fl/fl;AdipoQcre-positive mice (Fig. 6E). While the HFD increased skeletal expression of Dkk1 and sclerostin (Sost) in wild-type mice, the induction of Sost and Dkk1 was greatly reduced in Dkk1fl/fl;AdipoQcre-positive mice, even though only Sost expression was statistically significantly reduced (Fig. 6F and G). Again, no significant differences were detected between the genotypes for the RANKL(Tnfsf11)/OPG(Tnfsf11b) ratio within bone tissue (Fig. 6H).
Adipogenic Dkk1 cKO mice show no change in bone formation and bone resorption after HFD. Serum samples and vertebrae from 20-week-old Dkk1;AdipoQcre (Cre-negative and Cre-positive) mice after 12 weeks of normal (ND) or high-fat diet (HFD) were used for quantification of bone turnover makers and histological evaluation. Serum level of (A) bone formation marker type 1 procollagen amino-terminal-propeptide (P1NP). (B) Mineralizing surface per bone surface, (C) mineral apposition rate (MAR), and (D) bone formation rate per bone surface (BFR/BS) were determined in tibia sections. (E) Bone resorption marker C-terminal telopeptide (CTX). (F) Dickkopf-1 (Dkk1), (G) sclerostin (Sost), and (H) receptor activator of nuclear factor-κB-ligand/osteoprotegerin (RANKL/OPG) gene expression from bone was analyzed by real-time PCR. Data represent the mean ± s.d. N = 4–7 per group. Statistical analysis was performed by two-way ANOVA. Statistical significance is shown in the graphs. *P < 0.05, **P < 0.01, ***P < 0.001.
Citation: Endocrine Connections 12, 11; 10.1530/EC-23-0251
Discussion
In this study, we investigated the role of adipogenic Dkk1 in bone remodeling and its potential involvement in obesity-induced bone loss. Investigations performed in steady state demonstrate that young male mice lacking adipogenic Dkk1 exhibited a significant increase in trabecular bone volume in both the vertebrae and femoral bones. The finding of increased trabecular bone volume is consistent with previous studies that have suggested a role for Dkk1 in regulating bone mass (30, 31, 32, 33, 34). However, our study adds to the existing knowledge by demonstrating a specific role for adipogenic Dkk1 in regulating bone mass in young male mice. In addition, the observed reduction in the number of osteoclasts and adipocytes in the vertebral bones of Dkk1-deficient mice suggests a potential role for adipogenic Dkk1 in the regulation of both osteoclast and adipocyte differentiation that may provide a mechanistic explanation for the increase in trabecular bone volume. Osteoclasts are responsible for bone resorption (35, 36, 37, 38, 39), and a reduction in their number would lead to a decrease in bone breakdown, thus preserving bone mass (40). Adipocytes are also known to play a role in bone metabolism (41, 42, 43), and their reduction may contribute to the observed increase in bone mass. Although a loss of fat mass in the gonadal and subcutaneous fat depots was observed, body weight remained unchanged, which suggests a potential shift in substrate utilization. Interestingly, the effect of adipogenic Dkk1 on bone homeostasis was transient and did not persist at an older age (i.e. with 20 weeks of age). These observations suggest that the effect of adipogenic Dkk1 deletion on bone mass may be age dependent. Previous studies have shown that the role of Dkk1 in bone remodeling is complex and varies depending on the stage of skeletal development and the type of bone being examined (44, 45, 46, 47, 48). In addition, it is well-known that adipogenesis increases with aging and is linked with reduced bone formation (49, 50). Of note, serum levels of Dkk1 were not reduced anymore in adult mice lacking adipogenic Dkk1, suggesting that during adulthood, other cell types, such as osteoprogenitors, produce most of the circulating Dkk1 and thus, that the role of adipogenic Dkk1 may lose significance (51).
Afterward, we investigated whether Dkk1fl/fl;AdipoQcre-positive mice were protected from HFD-induced bone loss. When Dkk1fl/fl;AdipoQcre mice were fed an HFD, both the control and Dkk1fl/fl;AdipoQcre mice gained weight and exhibited increased subcutaneous and gonadal fat mass. Even though young Dkk1fl/fl;AdipoQcre mice showed increased bone mass compared to control mice, they were unable to maintain bone mass and instead lost a similar amount of bone after HFD challenge as control mice. Our findings from femoral bones are consistent with previous studies that have suggested that obesity can lead to bone loss (52, 53) by promoting the differentiation of adipocytes at the expense of osteoblasts (42). However, in this study, HFD did not induce bone loss at the vertebrae, which is in contrast to previous studies (51, 54), but may suggest that the femoral bone is more susceptible to metabolic changes due to obesity than vertebral bone. Nonetheless, inhibition of bone formation was observed due to HFD in both genotypes. These data are in line with our previous study investigating the role of osteogenic Dkk1 in obesity-induced bone loss. Therein, the lack of Dkk1 in osteogenic cells was also not able to rescue obesity-induced suppression of bone formation. Interestingly, we found that Dkk1-deficient mice fed an HFD had significantly lower expression of Sost, a Wnt signaling inhibitor that is known to play a role in the regulation of bone formation and resorption (55, 56). However, this was not sufficient to rescue bone formation under HFD conditions. Finally, unlike in mice with osteogenic Dkk1 deficiency (51), we did not find evidence of normalized bone resorption in mice lacking adipogenic Dkk1 on an HFD, even though in the steady-state conditions, adipogenic deficiency of Dkk1 also resulted in suppressed numbers of osteoclasts. Interestingly, the RANKL/OPG ratio in bone was not altered, indicating that either other cells produced an osteoclast-unfavorable low ratio of RANKL/OPG or that other osteoclast inhibitory factors were produced in bone (or elsewhere) that were not captured in this study.
Despite its strengths, our study has potential limitations. First, only male mice were included. Previous studies have shown that sex hormones may influence bone outcomes (57, 58), and further work needs to be done to understand the underlying mechanisms involved. Tamoxifen use has been shown to interfere with bone metabolism and can lead to decreased bone density in female mice (59). Therefore, to avoid the potential confounding effects of tamoxifen on bone metabolism, we limited our study to male mice. Of note, the deletion efficiency of Dkk1 in adipose tissue only reached about 50–70%. Thus, it may be that residual Dkk1 expression by adipocytes diluted some effects. Second, we observed some weight variations in mice on the HFD that could be due to metabolic differences between mice, which may have influenced the results. Despite these limitations, the study has several strengths. We used standardized diets and housing conditions for the mice and achieved an appropriate sample size to evaluate the effects of obesity-induced bone loss. Furthermore, the experiments were repeated in three independent cohorts to confirm the impact of Dkk1-derived adipocytes on bone remodeling. These strengths increase the reliability of our findings and provide valuable insights into the role of adipogenic Dkk1 in bone metabolism.
Overall, this study provides insights into the role of Dkk1 derived from adipocytes in bone homeostasis and metabolic bone disease. It shows that adipogenic Dkk1 may regulate bone mass in 12-week-old male mice, while it does not control bone homeostasis in adulthood or during obesity. Further studies focusing on the molecular mechanisms underlying the effects of adipogenic Dkk1 on bone mass accrual and its interactions with other signaling pathways may help to identify novel therapeutic targets for the treatment of bone loss in obesity.
Declaration of interest
All authors state that they have no conflicts of interest.
Funding
This work was supported by FIDELIO, which is an MSCA Innovative Training Network and receives funding from the European Union’s Horizon 2020 program under Grant Agreement No. 860898.
Author contribution statement
SD and MR designed the experiments. SD performed all mouse experiments and analyzed the data. ST performed mouse experiments. SD and MR drafted the manuscript. All authors critically read, reviewed, and approved the final version of the manuscript.
Data availability statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Acknowledgements
This work was funded and supported by the European Union’s Horizon 2020 research and innovation program under the MARIE SKLODOWSKA-CURIE grant agreement no. 860898 (‘FIDELIO’).
References
- 1↑
Johnell O, & Kanis JA. An estimate of the worldwide prevalence and disability associated with osteoporotic fractures. Osteoporosis International 2006 17 1726–1733. (https://doi.org/10.1007/s00198-006-0172-4)
- 2↑
Kanis JA, Johnell O, Oden A, Johansson H, & McCloskey E. FRAXTM and the assessment of fracture probability in men and women from the UK. Osteoporosis International 2008 19 385–397. (https://doi.org/10.1007/s00198-007-0543-5)
- 3↑
Black DM, & Rosen CJ. Clinical practice. Postmenopausal osteoporosis. New England Journal of Medicine 2016 374 254–262. (https://doi.org/10.1056/NEJMcp1513724)
- 4↑
Compston J, Cooper A, Cooper C, Gittoes N, Gregson C, Harvey N, Hope S, Kanis JA, McCloskey EV, Poole KES, et al. UK clinical guideline for the prevention and treatment of osteoporosis. Archives of Osteoporosis 2017 12 43. (https://doi.org/10.1007/s11657-017-0324-5)
- 5↑
Rizzoli R, & Bonjour JP. Dietary protein and bone health. Journal of Bone and Mineral Research 2004 19 527–531. (https://doi.org/10.1359/JBMR.040204)
- 6↑
Christensen K, Doblhammer G, Rau R, & Vaupel JW. Ageing populations: the challenges ahead. Lancet 2009 374 1196–1208. (https://doi.org/10.1016/S0140-6736(0961460-4)
- 7↑
Bray GA. Energy and fructose from beverages sweetened with sugar or high-fructose corn syrup pose a health risk for some people. Advances in Nutrition 2013 4 220–225. (https://doi.org/10.3945/an.112.002816)
- 8↑
Malik VS, Willett WC, & Hu FB. Global obesity: trends, risk factors and policy implications. Nature Reviews. Endocrinology 2013 9 13–27. (https://doi.org/10.1038/nrendo.2012.199)
- 9↑
Rillamas-Sun E, LaCroix AZ, Waring ME, Kroenke CH, LaMonte MJ, Vitolins MZ, Seguin R, Bell CL, Gass M, Manini TM, et al. Obesity and late-age survival without major disease or disability in older women. JAMA Internal Medicine 2014 174 98–106. (https://doi.org/10.1001/jamainternmed.2013.12051)
- 10↑
Greco EA, Lenzi A, & Migliaccio S. The obesity of bone. Therapeutic Advances in Endocrinology and Metabolism 2015 6 273–286. (https://doi.org/10.1177/2042018815611004)
- 11↑
Tu KN, Lie JD, Wan CKV, Cameron M, Austel AG, Nguyen JK, Van K, & Hyun D. Osteoporosis: a review of treatment options. Pharmacy and Therapeutics 2018 43 92–104.
- 12↑
Tsourdi E, Colditz J, Lademann F, Rijntjes E, Köhrle J, Niehrs C, Hofbauer LC, & Rauner M. The role of dickkopf-1 in thyroid hormone-induced changes of bone remodeling in male mice. Endocrinology 2019 160 664–674. (https://doi.org/10.1210/en.2018-00998)
- 13↑
Colditz J, Thiele S, Baschant U, Garbe AI, Niehrs C, Hofbauer LC, & Rauner M. Osteogenic Dkk1 mediates glucocorticoid-induced but not arthritis-induced bone loss. Journal of Bone and Mineral Research 2019 34 1314–1323. (https://doi.org/10.1002/jbmr.3702)
- 14↑
Picke AK, Sylow L, Møller LLV, Kjøbsted R, Schmidt FN, Steejn MW, Salbach-Hirsch J, Hofbauer C, Blüher M, Saalbach A, et al. Differential effects of high-fat diet and exercise training on bone and energy metabolism. Bone 2018 116 120–134. (https://doi.org/10.1016/j.bone.2018.07.015)
- 15↑
Gao Y, Li J, Xu X, Wang S, Yang Y, Zhou J, Zhang L, Zheng F, Li X, & Wang B. Embelin attenuates adipogenesis and lipogenesis through activating canonical Wnt signaling and inhibits high-fat diet-induced obesity. International Journal of Obesity 2017 41 729–738. (https://doi.org/10.1038/ijo.2017.35)
- 16↑
Gaudio A, Pennisi P, Bratengeier C, Torrisi V, Lindner B, Mangiafico RA, Pulvirenti I, Hawa G, Tringali G, & Fiore CE. Increased sclerostin serum levels associated with bone formation and resorption markers in patients with immobilization-induced bone loss. Journal of Clinical Endocrinology and Metabolism 2010 95 2248–2253. (https://doi.org/10.1210/jc.2010-0067)
- 17↑
Mäkitie RE, Kämpe A, Costantini A, Alm JJ, Magnusson P, & Mäkitie O. Biomarkers in WNT1 and PLS3 osteoporosis: altered concentrations of DKK1 and FGF23. Journal of Bone and Mineral Research 2020 35 901–912. (https://doi.org/10.1002/jbmr.3959)
- 18↑
McDonald MM, Morse A, Schindeler A, Mikulec K, Peacock L, Cheng T, Bobyn J, Lee L, Baldock PA, Croucher PI, et al. Homozygous Dkk1 knockout mice exhibit high bone mass phenotype due to increased bone formation. Calcified Tissue International 2018 102 105–116. (https://doi.org/10.1007/s00223-017-0338-4)
- 19↑
Morse A, Ko FC, McDonald MM, Lee LR, Schindeler A, Meulen van der MCH, & Little DG. Increased anabolic bone response in Dkk1 KO mice following tibial compressive loading. Bone 2020 131 115054. (https://doi.org/10.1016/j.bone.2019.115054)
- 20↑
Colditz J, Picke AK, Hofbauer LC, & Rauner M. Contributions of Dickkopf-1 to obesity-induced bone loss and marrow adiposity. JBMR Plus 2020 4 e10364. (https://doi.org/10.1002/jbm4.10364)
- 21↑
Christodoulides C, Laudes M, Cawthorn WP, Schinner S, Soos M, O’Rahilly S, Sethi JK, & Vidal-Puig A. The Wnt antagonist Dickkopf-1 and its receptors are coordinately regulated during early human adipogenesis. Journal of Cell Science 2006 119 2613–2620. (https://doi.org/10.1242/jcs.02975)
- 22↑
Park JR, Jung JW, Lee YS, & Kang KS. The roles of Wnt antagonists Dkk1 and sFRP4 during adipogenesis of human adipose tissue-derived mesenchymal stem cells. Cell Proliferation 2008 41 859–874. (https://doi.org/10.1111/j.1365-2184.2008.00565.x)
- 23↑
Gustafson B, & Smith U. The WNT inhibitor dickkopf 1 and bone morphogenetic protein 4 rescue adipogenesis in hypertrophic obesity in humans. Diabetes 2012 61 1217–1224. (https://doi.org/10.2337/db11-1419)
- 24↑
Pietilä I, Ellwanger K, Railo A, Jokela T, Barrantes Idel B, Shan J, Niehrs C, & Vainio SJ. Secreted Wnt antagonist Dickkopf-1 controls kidney papilla development coordinated by Wnt-7b signalling. Developmental Biology 2011 353 50–60. (https://doi.org/10.1016/j.ydbio.2011.02.019)
- 25↑
Colditz J, Thiele S, Baschant U, Niehrs C, Bonewald LF, Hofbauer LC, & Rauner M. Postnatal skeletal deletion of Dickkopf-1 increases bone formation and bone volume in male and female mice, despite increased sclerostin expression. Journal of Bone and Mineral Research 2018 33 1698–1707. (https://doi.org/10.1002/jbmr.3463)
- 26↑
Colditz J, Picke AK, Hofbauer LC, & Rauner M. Contributions of Dickkopf-1 to obesity-induced bone loss and marrow adiposity. JBMR Plus 2020 4 e10364. (https://doi.org/10.1002/jbm4.10364)
- 27↑
Dempster DW, Compston JE, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM, Recker RR, & Parfitt AM. Standardized nomenclature, symbols, and units for bone histomorphometry: a 2012 update of the report of the ASBMR Histomorphometry Nomenclature Committee. Journal of Bone and Mineral Research 2013 28 2–17. (https://doi.org/10.1002/jbmr.1805)
- 28↑
Pietilä I, Ellwanger K, Railo A, Jokela T, Barrantes Idel B, Shan J, Niehrs C, & Vainio SJ. Secreted Wnt antagonist Dickkopf-1 controls kidney papilla development coordinated by Wnt-7b signalling. Developmental Biology 2011 353 50–60. (https://doi.org/10.1016/j.ydbio.2011.02.019)
- 29↑
Liu Z, Chen T, Zhang S, Yang T, Gong Y, Deng HW, Bai D, Tian W, & Chen YP. Discovery and functional assessment of a novel adipocyte population driven by intracellular Wnt/β-catenin signaling in mammals. eLife 2022 11. (https://doi.org/10.7554/eLife.77740)
- 30↑
Chiarito M, Piacente L, Chaoul N, Pontrelli P, D’Amato G, Grandone A, Russo G, Street ME, Wasniewska MG, Brunetti G, et al. Role of Wnt-signaling inhibitors DKK-1 and sclerostin in bone fragility associated with Turner syndrome. Journal of Endocrinological Investigation 2022 45 1255–1263. (https://doi.org/10.1007/s40618-022-01760-3)
- 31↑
Daoussis D, & Andonopoulos AP. The emerging role of Dickkopf-1 in bone biology: is it the main switch controlling bone and joint remodeling? Seminars in Arthritis and Rheumatism 2011 41 170–177. (https://doi.org/10.1016/j.semarthrit.2011.01.006)
- 32↑
Butler JS, Murray DW, Hurson CJ, Obrien J, Doran PP, & Obyrne JM. The role of Dkk1 in bone mass regulation: correlating serum Dkk1 expression with bone mineral density. Journal of Orthopaedic Research 2011 29 414–418. (https://doi.org/10.1002/jor.21260)
- 33↑
Zhang W, & Drake MT. Potential role for therapies targeting DKK1, LRP5, and serotonin in the treatment of osteoporosis. Current Osteoporosis Reports 2012 10 93–100. (https://doi.org/10.1007/s11914-011-0086-8)
- 34↑
Pinzone JJ, Hall BM, Thudi NK, Vonau M, Qiang YW, Rosol TJ, & Shaughnessy JD. The role of Dickkopf-1 in bone development, homeostasis, and disease. Blood 2009 113 517–525. (https://doi.org/10.1182/blood-2008-03-145169)
- 35↑
Raggatt LJ, & Partridge NC. Cellular and molecular mechanisms of bone remodeling. Journal of Biological Chemistry 2010 285 25103–25108. (https://doi.org/10.1074/jbc.R109.041087)
- 36↑
Nollet M, Santucci-Darmanin S, Breuil V, Al-Sahlanee R, Cros C, Topi M, Momier D, Samson M, Pagnotta S, Cailleteau L, et al. Autophagy in osteoblasts is involved in mineralization and bone homeostasis. Autophagy 2014 10 1965–1977. (https://doi.org/10.4161/auto.36182)
- 37↑
Guo J, Ren R, Sun K, Yao X, Lin J, Wang G, Guo Z, Xu T, & Guo F. PERK controls bone homeostasis through the regulation of osteoclast differentiation and function. Cell Death and Disease 2020 11 847. (https://doi.org/10.1038/s41419-020-03046-z)
- 38↑
Sivaraj KK, Majev PG, Jeong HW, Dharmalingam B, Zeuschner D, Schröder S, Bixel MG, Timmen M, Stange R, & Adams RH. Mesenchymal stromal cell-derived septoclasts resorb cartilage during developmental ossification and fracture healing. Nature Communications 2022 13 571. (https://doi.org/10.1038/s41467-022-28142-w)
- 39↑
Lorenzo J. The many ways of osteoclast activation. Journal of Clinical Investigation 2017 127 2530–2532. (https://doi.org/10.1172/JCI94606)
- 40↑
Yang YS, Xie J, Chaugule S, Wang D, Kim JM, Kim JH, Tai PWL, Seo-kyo S, Gravallese E, Gao G, et al. Bone-targeting AAV-mediated gene silencing in osteoclasts for osteoporosis therapy. Molecular Therapy - Methods and Clinical Development 2020 17 922–935. (https://doi.org/10.1016/j.omtm.2020.04.010)
- 41↑
Beresford JN, Bennett JH, Devlin C, Leboy PS, & Owen ME. Evidence for an inverse relationship between the differentiation of adipocytic and osteogenic cells in rat marrow stromal cell cultures. Journal of Cell Science 1992 102 341–351. (https://doi.org/10.1242/jcs.102.2.341)
- 42↑
Duque G. G. Bone and fat connection in aging bone. Current Opinion in Rheumatology 2008 20 429–434. (https://doi.org/10.1097/BOR.0b013e3283025e9c)
- 43↑
Gimble JM, Zvonic S, Floyd ZE, Kassem M, & Nuttall ME. Playing with bone and fat. Journal of Cellular Biochemistry 2006 98 251–266. (https://doi.org/10.1002/jcb.20777)
- 44↑
Merz M, Merz AMA, Wang J, Wei L, Hu Q, Hutson N, Rondeau C, Celotto K, Belal A, Alberico R, et al. Deciphering spatial genomic heterogeneity at a single cell resolution in multiple myeloma. Nature Communications 2022 13 807. (https://doi.org/10.1038/s41467-022-28266-z)
- 45↑
Reppe S, Lien TG, Hsu YH, Gautvik VT, Olstad OK, Yu R, Bakke HG, Lyle R, Kringen MK, Glad IK, et al. Distinct DNA methylation profiles in bone and blood of osteoporotic and healthy postmenopausal women. Epigenetics 2017 12 674–687. (https://doi.org/10.1080/15592294.2017.1345832)
- 46↑
Nagano K, Yamana K, Saito H, Kiviranta R, Pedroni AC, Raval D, Niehrs C, Gori F, & Baron R. R-spondin 3 deletion induces Erk phosphorylation to enhance Wnt signaling and promote bone formation in the appendicular skeleton. eLife 2022 11. (https://doi.org/10.7554/eLife.84171)
- 47↑
Morvan F, Boulukos K, Clément-Lacroix P, Roman SR, Suc-Royer I, Vayssière B, Ammann P, Martin P, Pinho S, Pognonec P, et al. Deletion of a single allele of the Dkk1 gene leads to an increase in bone formation and bone mass. Journal of Bone and Mineral Research 2006 21 934–945. (https://doi.org/10.1359/jbmr.060311)
- 48↑
Polakowski N, Gregory H, Mesnard JM, & Lemasson I. Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain. Retrovirology 2010 7 61. (https://doi.org/10.1186/1742-4690-7-61)
- 49↑
Letarouilly JG, Broux O, & Clabaut A. New insights into the epigenetics of osteoporosis. Genomics 2019 111 793–798. (https://doi.org/10.1016/j.ygeno.2018.05.001)
- 50↑
Suo J, Zou S, Wang J, Han Y, Zhang L, Lv C, Jiang B, Ren Q, Chen L, Yang L, et al. The RNA-binding protein Musashi2 governs osteoblast-adipocyte lineage commitment by suppressing PPARγ signaling. Bone Research 2022 10 31. (https://doi.org/10.1038/s41413-022-00202-3)
- 51↑
Colditz J, Picke AK, Hofbauer LC, & Rauner M. Contributions of Dickkopf-1 to obesity-induced bone loss and marrow adiposity. JBMR Plus 2020 4 e10364. (https://doi.org/10.1002/jbm4.10364)
- 52↑
Mesinovic J, Jansons P, Zengin A, Courten de B, Rodriguez AJ, Daly RM, Ebeling PR, & Scott D. Exercise attenuates bone mineral density loss during diet-induced weight loss in adults with overweight and obesity: a systematic review and meta-analysis. Journal of Sport and Health Science 2021 10 550–559. (https://doi.org/10.1016/j.jshs.2021.05.001)
- 53↑
Piñar-Gutierrez A, García-Fontana C, García-Fontana B, & Muñoz-Torres M. Obesity and bone health: a complex relationship. International Journal of Molecular Sciences 2022 23 1–25. (https://doi.org/10.3390/ijms23158303)
- 54↑
Shu L, Beier E, Sheu T, Zhang H, Zuscik MJ, Puzas EJ, Boyce BF, Mooney RA & & Xing L. High-fat diet causes bone loss in young mice by promoting osteoclastogenesis through alteration of the bone marrow environment. Calcified Tissue International 2015 96 313–323. (https://doi.org/10.1007/s00223-015-9954-z)
- 55↑
Li X, Ominsky MS, Warmington KS, Morony S, Gong J, Cao J, Gao Y, Shalhoub V, Tipton B, Haldankar R, et al. Sclerostin antibody treatment increases bone formation, bone mass, and bone strength in a rat model of postmenopausal osteoporosis. Journal of Bone and Mineral Research 2009 24 578–588. (https://doi.org/10.1359/jbmr.081206)
- 56↑
Wijenayaka AR, Kogawa M, Lim HP, Bonewald LF, Findlay DM, & Atkins GJ. Sclerostin stimulates osteocyte support of osteoclast activity by a RANKL-dependent pathway. PLoS One 2011 6 e25900. (https://doi.org/10.1371/journal.pone.0025900)
- 57↑
Lorenzo J. Sexual dimorphism in osteoclasts. Cells 2020 9. (https://doi.org/10.3390/cells9092086)
- 58↑
Bandeira F, Lazaretti-Castro M, & Bilezikian JP. Hormones and bone. Arquivos Brasileiros de Endocrinologia e Metabologia 2010 54 85–86. (https://doi.org/10.1590/S0004-27302010000200001)
- 59↑
Powles TJ, Hickish T, Kanis JA, Tidy A, & Ashley S. Effect of tamoxifen on bone mineral density measured by dual-energy x-ray absorptiometry in healthy premenopausal and postmenopausal women. Journal of Clinical Oncology 1996 14 78–84. (https://doi.org/10.1200/JCO.1996.14.1.78)
