Abstract
The nutritional environment during development periods induces metabolic programming, leading to metabolic disorders and detrimental influences on human reproductive health. This study aimed to determine the long-term adverse effect of intrauterine malnutrition on the reproductive center kisspeptin-neurokinin B-dynorphin A (KNDy) neurons in the hypothalamic arcuate nucleus (ARC) of female offspring. Twelve pregnant rats were divided into ad-lib-fed (control, n = 6) and 50% undernutrition (UN, n = 6) groups. The UN group was restricted to 50% daily food intake of the control dams from gestation day 9 until term delivery. Differences between the two groups in terms of various maternal parameters, including body weight (BW), pregnancy duration, and litter size, as well as birth weight, puberty onset, estrous cyclicity, pulsatile luteinizing hormone (LH) secretion, and hypothalamic gene expression of offspring, were determined. Female offspring of UN dams exhibited low BW from birth to 3 weeks, whereas UN offspring showed signs of precocious puberty; hypothalamic Tac3 (a neurokinin B gene) expression was increased in prepubertal UN offspring, and the BW at the virginal opening was lower in UN offspring than that in the control group. Interestingly, the UN offspring showed significant decreases in the number of KNDy gene-expressing cells after 29 weeks of age, but the number of ARC kisspeptin-immunoreactive cells, pulsatile LH secretions, and estrous cyclicity were comparable between the groups. In conclusion, intrauterine undernutrition induced various changes in KNDy gene expression depending on the life stage. Thus, intrauterine undernutrition affected hypothalamic developmental programming in female rats.
Introduction
Maternal nutrition during pregnancy and lactation profoundly affects the intrauterine environment, leading to developmental programming in various organs and systems in the offspring (1). This concept, called the developmental origins of health and disease (DOHaD) hypothesis, has been linked to the pathogenesis of metabolic disorders, such as cardiovascular functions (2), kidney functions (3), metabolic syndrome (4), and insulin resistance (5), and obstetrics and gynecology diseases, such as puberty and menstrual disorders, as well as polycystic ovarian syndrome (6). Besides human clinical studies, DOHaD-related reproductive changes have been shown in the offspring of ewes (7, 8, 9, 10), cows (11), mice (12), and rats (13). Maternal nutrient restriction impairs the offspring's ovarian function, such as delayed fetal follicular development in sheep (14), decreased antral follicle numbers in rats and cows (15, 16, 17), and reduced adult progesterone levels later in life in rats (18). The rat offspring of undernourished dams also shows early ovarian aging, characterized by a loss of ovarian follicular reserve and ovarian antioxidant defense impairment in adult rats (15). Furthermore, low birth weight (LBW) causes precocious puberty and age-related abnormalities of estrous cyclicity in rats (18, 19). Thus, a poor nutritional environment during development periods affects reproductive functions later in life; however, its neuroendocrine mechanisms are unknown.
The kisspeptin-GPR54 system has been considered a central reproductive mechanism because the mutations of Gpr54 (a kisspeptin receptor gene) and Kiss1 (a kisspeptin gene) in human and rodent models cause puberty failure and reproductive dysfunction in adulthood (20, 21, 22, 23). Kisspeptin neurons in the arcuate nucleus (ARC) coexpress neurokinin B (NKB) and dynorphin A (Dyn), designated as KNDy neurons, and have been considered as an intrinsic gonadotropin-releasing hormone (GnRH)/gonadotropin pulse generator regulating gametogenesis and steroidogenesis in male and female mammals (24, 25, 26, 27). Environmental stresses during development periods such as prenatal androgen excess (28), postnatal estrogen exposure (29, 30), and perinatal overnutrition (31) affect the ARC Kiss1 expression and/or thereby pulsatile luteinizing hormone (LH) secretion in adulthood. Furthermore, undernutrition during postnatal periods alters pubertal timing due to changes in hypothalamic Kiss1 expression in female rats (32). However, it is still unclear whether intrauterine malnutrition has long-term adverse effects on ARC KNDy neurons of the female offspring later in life.
The present study investigated the long-term effects of maternal 50% undernutrition on the expression of KNDy genes in female rats at prepuberty and adulthood. Puberty timing, estrous cyclicity, and pulsatile LH secretion were also evaluated to determine if alteration of the KNDy system contributes to the reproductive disorder in prenatally undernourished rats. Additionally, body weight (BW), food intake, accumulation of visceral adiposity, and plasma triglyceride levels as an indicator of metabolic status were assessed.
Materials and methods
Animals
Twelve pregnant, 11 weeks old Wistar-Imamichi strain rats at gestation day (GD) 5 were purchased from Institute for Animal Reproduction (Kasumigaura, Japan). They were housed individually in the facilities at the Nippon Medical School in a controlled environment (14 h light:10 h darkness, lights on at 05:00 h, at 22 ± 2°C) with free access to food and water. The fetal malnutrition model in this study used a modified protocol reported by Slaboda et al. in 2009 (18). The pregnant rats were divided into ad-lib-fed (control, n = 6) and 50% undernutrition (UN, n = 6) groups. Based on the preliminary experiment for measuring the control group's food intake during gestation, the UN group was fed 50% of the control groups, daily 4 g/100 g BW, during the feeding restriction. Considering that implantation of a fertilized ovum is completed by GD8 in rats (33), restriction feeding for the UN dams was started on GD9. They were restricted to 50% daily food intake of the control dams from GD9 until term delivery. The pups' delivery day was designated day 0 postpartum. BW and sex ratio of pups and litter size were checked, and the litter size was adjusted to eight pups on postnatal day (PND) 1 (Table 1). Upon litter adjustment, female neonates were retained for further analysis. In total, there were 42 female neonates in the control group and 43 in the UN group, and they were weighed weekly until weaning. The weight of neonates was first measured at PND1 because dams are highly sensitive to environmental stimuli following delivery. Of these, some females (n = 7–8) were randomly selected for brain sampling at weaning at PND21. Other 11 female rats from each of the control and UN groups were randomly housed with two or three animals per cage and placed on a normal diet (catalog D12450H; Research Diets, New Brunswick, NJ, USA) for the duration of the study until the animals were sacrificed. The experimental design is provided in Fig. 1A. Since 1 of the 11 animals in both groups eventually died, statistical analysis was performed on the 10 animals for each group for which all BW and estrous cycle data were available. Of these 10 animals, some animals were randomly selected for LH pulse and histological analysis and measurement of the metabolic parameters.
Study schema. Dams were fed either standard chow ad libitum (Ctr) or 50% of the daily intake (UN) from gestational day 9 to delivery. All dams were fed ad libitum throughout lactation. At weaning (postnatal day 21), part of the Ctr and UN offspring was sacrificed for hypothalamic KNDy gene expression, and the other rats were placed on a normal diet fed ad libitum until the animals were sacrificed.
Citation: Endocrine Connections 12, 1; 10.1530/EC-22-0307
Effect of maternal food restriction on maternal body weight (BW), pregnancy period, litter size, sex ratio, and birth weight of offspring.
Ctr | UN | ||
---|---|---|---|
Mother | n | 6 | 6 |
Maternal BW at gestational day 9 | 271.02 ± 7.93 | 274.17 ± 7.70 | |
Maternal BW at gestational day 21 | 408.93 ± 12.89 | 315.63 ± 8.28* | |
Maternal BW changes during gestational days (%)a | 151.1 ± 2.0 | 113.5 ± 1.0* | |
Pregnancy period (day) | 22 | 22 | |
Litter size | 15.83 ± 0.91 | 15.50 ± 0.76 | |
Offspring | n b | 95 | 93 |
% of female rats | 44.84 ± 2.72 | 45.95 ± 6.48 | |
Birth weight of female rats (g) | 5.6 ± 0.1 | 5.2 ± 0.1* |
Data are represented as mean ± s.e.m. from Ctr or UN rats.
aMaternal BW changes showed the ratio of the BW at gestational day 9 to day 21.
bTotal offspring number on postnatal day 1 before litter adjustment.
*P < 0.05 compared with Ctr group (Student's t test).
Ctr, normal nutrition control rats; UN, undernutrition rats.
Surgical procedures for the animals were performed under isoflurane anesthesia. The animals were euthanized under deep anesthesia with sodium pentobarbital (100 mg/kg, intraperitoneally (i.p.)) and medetomidine hydrochloride (0.5 mg/kg, i.p.) to harvest brain tissues. The Nippon Medical School’s committee on animal research approved all the procedures and housing conditions used in the study.
Assessment of maternal undernutrition on reproductive and metabolic parameters in female offspring
The UN (n = 8) or control female offspring (n = 7) at the time of weaning were sacrificed by decapitation to examine hypothalamic KNDy gene expression in prepubertal rats. After removing the entire brain, the hypothalamic tissue, including the ARC and lateral hypothalamic area, was dissected out using a microknife from the coronal sections of the brains sliced with a brain slicer. The coordinates of the brain atlas (34) were 2.28 mm anterior to and 4.44 mm posterior to the bregma. Thereafter, the brain tissue was immediately immersed into ISOGEN (Nippon Gene, Toyama, Japan), homogenized, and stored at −25°C until used for quantitative PCR. The vaginal opening (VO) and first estrus were examined as pubertal signs onset in perinatally undernourished (n = 11) or control female rats (n = 11). Vaginal smears were checked from PND23 to PND70 days to examine the first vaginal estrous timing. The first day when the major cell population in the vaginal smear was cornified cells was designated as the day of the first vaginal estrous. After puberty, vaginal smears were examined daily for 2 weeks at 11, 16, 21, and 26 weeks of age to monitor estrous cyclicity. The length of estrous cycles was defined with the virginal smear date from the start of the estrus to the start of the next estrus. The average length of the observed estrous cycles over 2 weeks was calculated. Food consumption was monitored in some animals at 28–30 weeks of age before surgery. For assessment of pulsatile LH secretion and ARC Kiss1 and Tac3 gene expression, perinatally undernourished females (n = 8) or control females (n = 7) were bilaterally ovariectomized (OVX) to remove the influences of endogenous gonadal steroids at 30–41 weeks of age and received a s.c. silastic tubing (1.5 mm inner diameter; 3.0 mm outer diameter; 25.0 mm in length; Dow Corning, Midland, MI, USA) containing estradiol-17β (E2) (Sigma-Aldrich) dissolved in sesame oil at 20 μg/mL 1 week before blood sampling. A previous study demonstrated that rats subjected to this E2 treatment had diestrus plasma E2 levels (35). Blood samples were collected for 3 h at 6-min intervals from freely moving conscious rats from 13:00 h to detect pulsatile LH release. Blood samples (100 μL) were taken from the right atrial cannula (0.5 mm inner diameter and 1.0 mm outer diameter, Shin-Etsu Polymer, Tokyo, Japan) inserted through the jugular vein on the previous day. Each blood sample was replaced with an equivalent amount of washed red blood cells obtained from other rats of same strain to maintain the hematocrit constant. Plasma samples were obtained by immediate centrifugation and stored at −25°C until LH assay. On the next day, the blood (500 μL) for plasma triglyceride assay was additionally collected from the right atrial cannula under deep anesthesia with sodium pentobarbital, and visceral white adipose tissues (retroperitoneal, perirenal, and perigonadal adipose tissues) were weighted. The animals were then perfused with 4% paraformaldehyde (PFA) for histological analysis of the brain.
Quantitative real-time PCR (qPCR) to examine the hypothalamic KNDy gene expression of female offspring in the prepubertal period
Total RNA was extracted from the hypothalamic tissue of prepubertal rats using ISOGEN according to the manufacturer’s protocols. cDNA was synthesized with oligo dT primers at 50°C using the SuperScript III first-strand synthesis for real-time PCR (Invitrogen). qPCR was performed using fluorescent SYBR green (TB GreenTM Premix Ex TaqTM II, Takara Bio Inc.) and a Thermal Cycler Dice Real-Time System II (Takara Bio Inc.) according to the manufacturer’s instructions. The PCR conditions were as follows: initial denaturation at 95°C for 30 s, followed by 40 cycles of 5 s of denaturation at 95°C, and 30 s of annealing, and extension at 60°C. The oligonucleotide primer sequences and GenBank accession numbers used for qPCR are listed in Table 2. β-Actin (Actb) was used as the internal control. Dissociation curve analysis was also performed to ensure the specificity of the PCR.
Primer set sequences for real-time PCR used in this study.
Gene | Forward primer (5′ to 3′) | Reverse primer (5′ to 3′) | GeneBank accession ID |
---|---|---|---|
Actb | TGTCACCAACTGGGACGATA | GGGGTGTTGAAGGTCTTCAAA | NM_031144 |
Kiss1 | ATGATCTCGCTGGCTTCTTGG | GGTTCACCACAGGTGCCATTTT | XM_017598697 |
Tac3 | ATAGGCCAGCAGTGCAGAAA | AGCCAACAGGAGGACCTTG | NM_019162 |
Pdyn | CCTGTCCTTGTGTTCCCTGT | AGAGGCAGTCAGGGTGAGAA | NM_019374 |
KNDy gene in situ hybridization and kisspeptin immunohistochemistry of female offspring in the adult period
The UN (n = 8) or control (n = 7) female offspring were deeply anesthetized with sodium pentobarbital and perfused with 0.05 M PBS followed by 4% PFA under deep anesthesia with sodium pentobarbital. Brains were harvested immediately, postfixed in the same fixative overnight at 4°C, and then immersed in 20% sucrose in 0.05 M PBS at 4°C. The serial coronal sections (50 μm in thickness) were obtained using a cryostat for histological analysis. Every fourth section through the ARC (from 1.72 to 4.36 mm posterior to the bregma) was obtained from each rat according to the brain atlas (34) for Kiss1, Tac3, and Pdyn in situ hybridization (ISH) and kisspeptin immunohistochemistry (IHC). Each series of sections for ISH and IHC contained 12–15 ARC sections, confirming no significant difference in the number of brain sections between the groups. IHC and ISH were performed several times using antibodies and antisense probes whose specificity had been previously confirmed as described later, and the brain sections of both groups were stained in each experiment.
Kiss1, Tac3, and Pdyn mRNA expression were detected by free-floating ISH using specific digoxigenin (DIG)-labeled probes, as described elsewhere (36, 37). DIG-labeled antisense cRNA probes for rat Kiss1 (position 39–527; GenBank accession no. XM_017598697), Tac3 (position 180–483, GenBank accession no. NM_019162), and Pdyn (position 315–731, GenBank accession no. NM_019374) were synthesized by in vitro transcription from the rat hypothalamic cDNA using a DIG-labeling kit (Boehringer Mannheim GmbH, Mannheim, Germany). The specificity of the probes has been confirmed in the past by the fact that no positive signal for the Kiss1, Tac3, and Pdyn mRNA was detected in the brain sections hybridized with the corresponding sense probe (38). Briefly, the brain sections treated with 1 μg/mL proteinase K and 0.25% acetic anhydride in 0.1 M triethanolamine were hybridized with DIG-labeled probes. After hybridization, the sections were treated with 20 μg/mL RNase A (Roche Diagnostics), immersed in 1.5% blocking reagent solution (PerkinElmer), and then incubated with an alkaline phosphatase-conjugated anti-DIG antibody (1:1000, Roche Diagnostics, RRID: AB_514497). The sections were treated with 4-nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate solution (Roche Diagnostics) until a visible signal was detected. The sections were mounted and examined using an optical microscope (BX50; Olympus) after processing.
According to the method described in our recent report (39), free-floating IHC was performed to detect KISS1 (a kisspeptin protein)-immunoreactive cells. The specificity of KISS1 antibody has been previously demonstrated elsewhere (40). Every fourth section through the ARC was incubated with an anti-KISS1 mouse monoclonal antibody (1:50,000, Takeda #254, kindly donated by Takeda Pharmaceutical Co., Osaka, Japan, RRID: AB_2636957) overnight at 4°C, and the sections were treated with a biotin-conjugated secondary antibody (1:1 in PBST, Histofine SAB-PO kit, Nichirei Biosciences, Tokyo, Japan) for 2 h and then with horseradish peroxidase-conjugated streptavidin for 2 h the next day. Finally, the sections were stained with 3,3′-diaminobenzidine tetrahydrochloride (0.5 μg/mL, Sigma-Aldrich) with 0.03% H2O2 and then washed with distilled water thrice to stop the reaction. The bright-field images of the sections were obtained with an optical microscope (BX50; Olympus).
Assays for LH and triglyceride levels
Plasma LH concentrations were determined using a double-antibody RIA with a rat LH RIA kit provided by the National Hormone and Pituitary Program (Baltimore, MD, USA) and were expressed in terms of NIDDK-rLH-RP-3. The least detectable LH level was 0.156 ng/mL for the 50 μL plasma samples. The intra- and inter-assay coefficients of variation were 7.4 and 12.6% at 0.63 ng/mL for 50 μL plasma, respectively. Plasma triglyceride concentrations were determined using a commercial kit (Triglyceride E-test Wako; FUJIFILM Wako Pure Chemical Co.) following kit instructions.
Data analysis and statistics
Statistical differences in BW changes, the percentage of proestrus, estrus, and diestrus during the estrous cycle, and length of estrous cycles between two groups were determined by two-way ANOVA with maternal diet and time as main effects, followed by the Bonferroni test. Every fourth section through the ARC was counted, and one value/animal was used to quantify the number of Kiss1-, Tac3-, or Pdyn-expressing or KISS1-immunoreactive cells. LH pulses were identified using the PULSAR computer program (41). Statistical differences between the two groups in the other results, including maternal BW at GD9 or 21, maternal BW changes, pregnancy period, litter size, sex ratio of offspring, birth weight of offspring, adipose tissue weight of offspring, plasma triglyceride levels, food intake, each LH pulse parameter, and hypothalamic gene expression levels analyzed by qPCR and histological experiments were determined by the Student’s t-test.
Results
Establishing a model of low birth weight infants by maternal food restriction
There were no significant differences in BW between the two maternal groups (control groups and UN groups) on GD9; however, maternal food restriction caused a significant decrease in maternal BW on GD21 (Table 1). The maternal BW changes in the UN group from GD9 to GD21 were significantly lower than those of the control group (P < 0.05, Table 1). The BW at PND1 decreased in UN female pups compared to the control because of maternal food restriction (P < 0.05, Table 1) but was unaffected by other factors such as the pregnancy period, sex ratio, and litter size (Table 1). The BW in UN pups was significantly lower than that of control from PND1 to 3-week-old rats (P < 0.05, Table 1 and Fig. 2A).
Effect of intrauterine undernutrition on puberty onset of female rats. (A) Changes in body weight (BW) in female offspring of Ctr or UN dams before weaning. Values are mean ± s.e.m. *P < 0.05 (vs Ctr group, two-way). (B) Hypothalamic KNDy gene (Kiss1, Tac3, and Pdyn) expression in Ctr and UN offspring at weaning. The mRNA levels were determined by qPCR. Relative expression levels of each gene were normalized by β-actin gene (Actb) expression. (C) Percentage of animals showing vaginal opening (VO) or first estrus (FE). (D) Ages (left) and BW (right) at VO. (E) Ages at virginal FE. *P < 0.05 (vs. Ctr group, Student’s t-test). The bar charts portray the mean ± s.e.m. with the individual data points overlaid. The numbers in each column indicate the number of animals used. Ctr, offspring of ad-libitum-fed control dams; UN, offspring of undernourished dams.
Citation: Endocrine Connections 12, 1; 10.1530/EC-22-0307
Effect of intrauterine undernutrition on hypothalamic KNDy gene expression in immature female offspring
Prenatal undernutrition results in precocious puberty in female rats (Fig. 2), and UN offspring showed the lower BW until 3 weeks of age, as indicated in Fig. 2A. Figure 2B shows KNDy gene expression in the hypothalamus of prepubertal female rats; UN offspring showed a significant increase in Tac3 mRNA levels compared with the control (Fig. 2B, middle). UN offspring’s Pdyn mRNA levels decreased compared to the control, although the difference was not statistically significant (P = 0.07) (Fig. 2B, right). Kiss1 mRNA levels were comparable between the groups (Fig. 2B, left). A significant difference in the age at VO was not observed between the groups (Figs. 2C and D, left), but the BW at VO was significantly (P < 0.05) lower in UN offspring than that in the control (Fig. 2D, right). Fifty-five percent of the UN offspring showed virginal first estrous at 33 days of age, while only 9% of control offspring did at the time (Fig. 2C, right). The first estrous in UN offspring tended to be earlier (P = 0.053) than that in the control (Fig. 2E).
Effect of intrauterine undernutrition on metabolic parameters in mature female offspring
BW, fat accumulation, plasma triglyceride levels, and calorie intake were assessed in mature rats to evaluate whether prenatal undernutrition affects the metabolic parameters of mature offspring. The BW of UN offspring had caught up to that of the control offspring at 4 weeks of age, and thereafter, there were no significant differences in the BW between the two groups (Fig. 3A). However, the UN adult offspring showed a statistically significant (P < 0.05) increase in weight of visceral adiposity divided by the BW, plasma triglyceride levels, and calorie intake compared with control offspring in adulthood after 30 weeks of age (Fig. 3B).
Effect of intrauterine undernutrition on metabolic parameters of female rats. (A) Changes in BW in female offspring of Ctr or UN dams after weaning. Values are mean ± s.e.m. (B) Plasma triglyceride (TG) levels (left), weight of visceral adiposity divided by the BW (middle), and calorie intake (right) in each group. *P < 0.05 (vs Ctr group, Student’s t-test). The bar charts portray the mean ± s.e.m. with the individual data points overlaid. The numbers in each column indicate the number of animals used. Ctr, offspring of ad-libitum fed control dams; UN, offspring of undernourished dams.
Citation: Endocrine Connections 12, 1; 10.1530/EC-22-0307
Effect of intrauterine undernutrition on ARC KNDy gene expression in the mature female offspring
The ARC KNDy gene expression was identified in the E2-primed OVX mature offspring (Figs. 4A and B). The total numbers of ARC Kiss1-, Tac3-, and Pdyn -expressing cells in the UN offspring significantly decreased compared to those in the control rats (Fig. 4B). Further analysis of the ARC in three subregions (rostral, middle, and caudal) revealed significant differences in the number of Kiss1-expressing cells in the caudal ARC and Tac3-expression cells in the middle ARC and also a tendency to decrease in Pdyn-expression cells in the caudal ARC between the control and UN groups. The numbers of ARC KISS1-immunoreactive cells in the UN offspring were comparable with that in the control rats (Figs. 4C and D).
Effect of intrauterine undernutrition on ARC KNDy gene expression in mature female offspring. (A) Representative photomicrographs show Kiss1, Tac3, and Pdyn mRNA distribution using an antisense cRNA probe in the ARC. Scale bar, 100 μm. (B) The number of total Kiss1-, Tac3-, and Pdyn-expressing cells in the whole ARC, or the subtotal number in the rostral, middle, and caudal regions of the ARC. *P < 0.05 (vs the normal-diet controls, Student’s t-test). (C) Representative photomicrographs show KISS1-immunoreactive cells in the ARC. Scale bar, 100 μm. (D) The number of total kisspeptin-immunoreactive cells in the whole ARC, or the subtotal number in the rostral, middle, and caudal regions of the ARC. The bar charts portray the mean ± s.e.m. with the individual data points overlaid. Ctr, offspring of ad-libitum-fed control dams; UN, offspring of undernourished dams. All animals were OVX and received estradiol a week before the PFA perfusion.
Citation: Endocrine Connections 12, 1; 10.1530/EC-22-0307
Estrous cyclicity and pulsatile LH secretion in mature UN female offspring
Vaginal smear was analyzed for 2 weeks and at 11–13, 16–18, 21–23, and 26–28 weeks of age to determine the prenatal undernutrition effect on estrous cyclicity, which was disrupted with aging in both UN and control offspring. From 11 to 13 weeks of age, all offspring in both groups showed a regular 4-day estrous cycle (>3 cycles/2 weeks) (Figs. 5A and B). Similarly, almost all UN and control offspring showed a regular 4- or 5-day estrous cycle at 16–18 and 21–23 weeks of age (Fig. 5B). At 26–28 weeks of age, both UN and control offspring showed age-related changes in estrous cyclicity, such as unclear proestrus, extended diestrus, or extended estrus (Fig. 5A lower and 5C). Estrous cycle length showed no significant interaction between maternal diet and age; however, the age effect was significant, and the cycles of 26–28 weeks were significantly longer than those of 11–13 weeks (Fig. 5B).
Effect of intrauterine undernutrition on reproductive functions in mature female offspring. (A) Estrous cyclicity in the representative rats in each group at 11–13 and 26–28 weeks of age. Note that the vaginal smears were examined daily for 2 weeks. E, estrus; P, proestrus; D, diestrus. (B) The average length of the estrous cycle in each group (Ctr, n = 10; UN, n = 10) at 11–13, 16–18, 21–23, and 26–28 weeks. (C) The percentages of proestrus, estrus, and diestrus during 2 weeks in each group (Ctr, n = 10; UN, n = 10) at 11–13, 16–18, 21–23, and 26–28 weeks. (D) Plasma LH profiles in the representative animals from each group. All animals were OVX and received estradiol. After 1 week, blood samples were collected every 6 min for 3 h. Arrowheads indicate the peaks of the LH pulses as identified using the PULSAR computer program. (E) Frequency of the LH pulses, mean LH concentration, and amplitude of the LH pulses were calculated for a 3 h sampling period. *P < 0.05 (vs 11–13 weeks, two-way ANOVA followed by the Bonferroni test). The bar charts portray the mean ± s.e.m. with the individual data points overlaid. The numbers in each column indicate the number of animals used. Ctr, offspring of ad-libitum-fed control dams; UN, offspring of undernourished dams.
Citation: Endocrine Connections 12, 1; 10.1530/EC-22-0307
As for the profiles of LH release in the mature E2-primed OVX models, apparent LH pulses were found in both groups at 30–41 weeks of age (Fig. 5C). Prenatal undernutrition did not affect the mean LH levels and LH pulse amplitude and frequency of mature offspring (Fig. 5D).
Discussion
This study showed that prenatal undernutrition results in prepubertal increase in hypothalamic NKB gene (Tac3) expression, followed by a tendency to advance first virginal estrus. Conversely, UN significantly suppressed ARC KNDy gene expression in middle-aged rats after 30 weeks of age, suggesting that intrauterine undernutrition stress results in developmental programming of KNDy neurons, which changes in their gene expression depending on life stages. However, mature UN offspring showed normal estrous cycle and LH pulses similar to control offspring. Thus, a GnRH/LH pulse generator is a robust mechanism to maintain normal reproductive function against deterioration of the uterine nutritional environment. Additionally, prenatal undernutrition stimulates obesogenic effects, such as rapid catch-up growth at 4 weeks following LBW, visceral fat accumulation, and increased calorie intake and plasma triglyceride levels in adulthood. These metabolic symptoms agree with the thrifty phenotype hypothesis that an adverse intrauterine environment such as caloric restriction induces developmental programming of the fetal hypothalamus and peripheral organs, altering the fetal metabolic and hormonal milieu, predisposing to metabolic syndrome (42). The current study collectively demonstrated that intrauterine undernutrition caused hypothalamus developmental programming resulting in central precocious puberty and obesogenic profile, but not associated with GnRH/LH pulses at adulthood in female rats.
The prenatal-undernutrition-induced advanced first vaginal estrous may have occurred due to changes in prepubertal hypothalamic Tac3 gene expression since these genes have a stimulatory role in pulsatile GnRH/LH secretion (24). Previous pharmacological studies showed that administration of an NKB receptor agonist or a dynorphin receptor antagonist accelerated puberty onset in female rats (43, 44). Thus, intrauterine undernutrition might cause a prepubertal increase in Tac3 gene expression in KNDy neurons to accelerate puberty onset through pulsatile GnRH/LH secretion in the UN female offspring. The present fetal undernutrition showed a tendency toward a decrease in prepubertal hypothalamic Pdyn gene expression, which may also contribute to accelerating pulsatile GnRH/LH secretion.
Nutritional or energy status are important determinants of pubertal initiation, as indicated by delayed puberty due to food restriction and advanced puberty due to overnutrition in mammals (32, 45). Prepubertal female rats fed a high-fat diet induced rapid BW growth and then a profound advancement of puberty concomitant with a dramatic acceleration of LH pulse frequency that is paralleled by a significantly earlier dynamic rise in ARC Tac3 expression (45). It is suggested that ARC Tac3 is a central reproductive regulator of the timing of puberty in response to peripubertal metabolic changes. It is tempting to speculate that the peripubertal rapid catch-up growth of the UN rats in the current study may underlie the concomitant increase in hypothalamic Tac3 expression and then pubertal acceleration in the UN rats. Indeed, the previous study demonstrated that the UN offspring showed prepuberal obesogenic effects such as elevated leptin, rapid weight gain, and increased adipose tissue mass despite the low birth weight (46). Thus, the metabolic changes in the UN rats might alter hypothalamic Tac3 expression, resulting in the advanced first virginal estrus.
The present study showed the discrepancy between the decrease in the number of ARC KNDy neurons and unchanged LH pulses by fetal malnutrition, indicating the possibility of a compensatory mechanism against the reduction of ARC Kiss1 expression to maintain a regular pulsatile GnRH/LH secretion. Several mice models with ARC Kiss1 knockdown and global Kiss1 KO have also shown that a compensatory mechanism may rescue reproductive functions (47, 48). The present result showed an UN-induced reduction of cell number expressing Kiss1 or Tac3 in a different ARC subdivision, suggesting that it could be attributed to a suppression of KNDy gene expression in adulthood rather than cell death in the KNDy neurons during developmental periods. The notion is supported by the present result that UN animals showed comparable prepubertal hypothalamic Kiss1 levels and ARC KISS1 immunoreactivity to control groups. The normal ARC KISS1 immunoreactivity in the fetal UN likely implies that the peptide secretion from the ARC was also unchanged, resulting in regular GnRH/LH secretion in the UN rats. It should be noted that GnRH may also have a compensatory role in maintaining normal GnRH/LH pulses in the UN female rats, following a previous report that fetal UN caused increased hypothalamic Gnrh1 gene expression in 10-month-old female rats (19).
Our results showed accelerated sexual maturation that resulted from intrauterine undernutrition. Sloboda’s study also indicated that puberty was advanced by fetal undernutrition in female rat offspring born from mothers with 50% food restriction throughout gestation and/or lactation; the authors discussed their results based on life-history theory (18). The organism trades length of life for reproduction in a threatening circumstance; therefore, poor nutrition or threatening circumstances in early life leads to precocity (49). The theory is supported by clinical observations; LBW followed by accelerated postnatal growth has been associated with earlier menarche in humans (50, 51, 52, 53). Besides the accelerated sexual maturation, fetal undernutrition also resulted in ovulation disorders and low blood estrogen levels in middle age, which were associated with premature reproductive aging in female rats (19). These studies were also supported by our results showing a reduction of ARC KNDy gene expression in middle-aged UN offspring, but a limitation of the present study is that the long-term effects of the gene expression reductions on reproductive functions could not be examined. At the time of KNDy gene expression analysis in this study (i.e. 26–28 weeks of age), the sexual cycle was prolonged in both groups compared to that at 11–13 weeks. However, most animals exhibited a 4–5-day estrous cycle, suggesting that they were in the early stages of aging in the present study. Further studies with older UN animals than 29 weeks of age will be required to clarify this point.
The period of early gestation may be important for fetal hypothalamic programming in fetal UN-induced advanced puberty because maternal food restriction from GD9 to delivery tends to advance puberty in the offspring. Conversely, female rat offspring of restricted maternal food from GD14 to delivery showed delayed puberty due to suppression of prepubertal hypothalamic Kiss1 expression (32). The discrepancy between these results could be attributed to the difference in the maternal undernutrition period. Hence, hypothalamic fetal programming related to precocious puberty may require prolonged undernutrition in the fetus or the experience of nutritional deficiency by GD13.
This study demonstrated that intrauterine undernutrition affected hypothalamic developmental programming in female rats, which induced long-term effects on hypothalamic KNDy gene expression and could influence reproductive functions later in life. Intrauterine undernutrition induced rapid catch-up growth and metabolic changes during peripubertal periods that caused central precocious puberty by altering expression in hypothalamic KNDy gene. Furthermore, the fetal UN-induced decrease in ARC KNDy gene expression in middle-aged rats suggests that the fetal UN may accelerate the age-related decline in KNDy gene expression, eventually leading to central premature reproductive senescence in mature female rat offspring. In the preventive medicine context, this study provides evidence that maternal nutritional management is essential for offspring’s reproductive health and would be useful for medical treatment for reproductive disruption in patients with intrauterine growth retardation.
Declaration of interest
The authors declare no conflict of interest.
Funding
This work was supported in part by the Grants-in-Aid from the Japan Society for the Promotion of Science (grant numbers 20J40270, 20K16123, and 18K06860); the Nippon Medical School Grant-in-Aid for Young and Women Investigators; the Initiative for Realizing Diversity in the Research Environment from Ministry of Education, Culture, Sports, Science and Technology (MEXT); and the MEXT-supported Program for Strategic Research Foundation at Private Universities.
Data availability statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Acknowledgements
The authors thank the National Hormone and Peptide Program, National Institute of Diabetes and Digestive and Kidney Diseases, and are indebted to Dr A. F. Parlow for providing the LH assay kit and to Drs. G. R. Merriam and K. W. Wachter for help with the PULSAR computer program. They are grateful to Ms Yuka Suganuma (Persol Tempstaff Co., Ltd.) for the technical support. They would like to thank Editage (www.editage.com) for English language editing.
References
- 1↑
Zambrano E, Guzman C, Rodriguez-Gonzalez GL, Durand-Carbajal M, Nathanielsz PW. Fetal programming of sexual dev1elopment and reproductive function. Molecular and Cellular Endocrinology 2014 382 538–549. (https://doi.org/10.1016/j.mce.2013.09.008)
- 2↑
Barker DJP In utero programming of cardiovascular disease. Theriogenology 2000 53 555–574. (https://doi.org/10.1016/S0093-691X(99)00258-7)
- 3↑
Luyckx VA, Bertram JF, Brenner BM, Fall C, Hoy WE, Ozanne SE, Vikse BE. Effect of fetal and child health on kidney development and long-term risk of hypertension and kidney disease. Lancet 2013 382 273–283. (https://doi.org/10.1016/S0140-6736(13)60311-6)
- 4↑
Rinaudo P, Wang E. Fetal programming and metabolic syndrome. Annual Review of Physiology 2012 74 107–130. (https://doi.org/10.1146/annurev-physiol-020911-153245)
- 5↑
Duque-Guimaraes DE, Ozanne SE. Nutritional programming of insulin resistance: causes and consequences. Trends in Endocrinology and Metabolism 2013 24 525–535. (https://doi.org/10.1016/j.tem.2013.05.006)
- 6↑
Gluckman PD, Hanson MA. Evolution, development and timing of puberty. Trends in Endocrinology and Metabolism 2006 17 7–12. (https://doi.org/10.1016/j.tem.2005.11.006)
- 7↑
Gunn RG The effects of two nutritional environments from 6 weeks pre partum to 12 months of age on lifetime performance and reproductive potential of Scottish Blackface ewes in two adult environments. Animal Science 1977 25 155–164. (https://doi.org/10.1017/S0003356100039386)
- 8↑
Allden WG Undernutrition of the Merino sheep and its sequelae 5. The influence of severe growth retardation during early post-natal life on reproduction and growth in later life. Australian Journal of Agricultural Research 1979 30 939–948. (https://doi.org/10.1071/AR9790939)
- 9↑
Gunn RG, Sim DA, Hunter EA. Effects of nutrition in utero and in early life on the subsequent lifetime reproductive performance of Scottish Blackface ewes in two management systems. Animal Science 1995 60 223–230. (https://doi.org/10.1017/S1357729800008389)
- 10↑
Rhind SM, Elston DA, Jones JR, Rees ME, McMillen SR, Gunn RG. Effects of restriction of growth and development of Brecon Cheviot ewe lambs on subsequent lifetime reproductive performance. Small Ruminant Research 1998 30 121–126. (https://doi.org/10.1016/S0921-4488(98)00103-5)
- 11↑
Martin JL, Vonnahme KA, Adams DC, Lardy GP, Funston RN. Effects of dam nutrition on growth and reproductive performance of heifer calves. Journal of Animal Science 2007 85 841–847. (https://doi.org/10.2527/jas.2006-337)
- 12↑
Meikle D, Westberg M. Maternal nutrition and reproduction of daughters in wild house mice (Mus musculus). Reproduction 2001 122 437–442. (https://doi.org/10.1530/rep.0.1220437)
- 13↑
Guzman C, Cabrera R, Cardenas M, Larrea F, Nathanielsz PW, Zambrano E. Protein restriction during fetal and neonatal development in the rat alters reproductive function and accelerates reproductive ageing in female progeny. Journal of Physiology 2006 572 97–108. (https://doi.org/10.1113/jphysiol.2005.103903)
- 14↑
Rae MT, Palassio S, Kyle CE, Brooks AN, Lea RG, Miller DW, Rhind SM. Effect of maternal undernutrition during pregnancy on early ovarian development and subsequent follicular development in sheep fetuses. Reproduction 2001 122 915–922. (https://doi.org/10.1530/rep.0.1220915)
- 15↑
Bernal AB, Vickers MH, Hampton MB, Poynton RA, Sloboda DM. Maternal undernutrition significantly impacts ovarian follicle number and increases ovarian oxidative stress in adult rat offspring. PLoS One 2010 5 e15558. (https://doi.org/10.1371/journal.pone.0015558)
- 16↑
Mossa F, Carter F, Walsh SW, Kenny DA, Smith GW, Ireland JLH, Hildebrandt TB, Lonergan P, Ireland JJ, Evans ACO. Maternal undernutrition in cows impairs ovarian and cardiovascular systems in their offspring. Biology of Reproduction 2013 88 92. (https://doi.org/10.1095/biolreprod.112.107235)
- 17↑
Chan KA, Jazwiec PA, Gohir W, Petrik JJ, Sloboda DM. Maternal nutrient restriction impairs young adult offspring ovarian signaling resulting in reproductive dysfunction and follicle loss. Biology of Reproduction 2018 98 664–682. (https://doi.org/10.1093/biolre/ioy008)
- 18↑
Sloboda DM, Howie GJ, Pleasants A, Gluckman PD, Vickers MH. Pre- and postnatal nutritional histories influence reproductive maturation and ovarian function in the rat. PLoS One 2009 4 e6744. (https://doi.org/10.1371/journal.pone.0006744)
- 19↑
Khorram O, Keen-Rinehart E, Chuang TD, Ross MG, Desai M. Maternal undernutrition induces premature reproductive senescence in adult female rat offspring. Fertility and Sterility 2015 103 291–8.e2. (https://doi.org/10.1016/j.fertnstert.2014.09.026)
- 20↑
Seminara SB, Messager S, Chatzidaki EE, Thresher RR, Acierno JS Jr, Shagoury JK, Bo-Abbas Y, Kuohung W, Schwinof KM & Hendrick AG et al.The GPR54 gene as a regulator of puberty. New England Journal of Medicine 2003 349 1614–1627. (https://doi.org/10.1056/NEJMoa035322)
- 21↑
Dhillo WS, Chaudhri OB, Patterson M, Thompson EL, Murphy KG, Badman MK, McGowan BM, Amber V, Patel S & Ghatei MA et al.Kisspeptin-54 stimulates the hypothalamic-pituitary gonadal axis in human males. Journal of Clinical Endocrinology and Metabolism 2005 90 6609–6615. (https://doi.org/10.1210/jc.2005-1468)
- 22↑
Dungan HM, Gottsch ML, Zeng H, Gragerov A, Bergmann JE, Vassilatis DK, Clifton DK, Steiner RA. The role of kisspeptin-GPR54 signaling in the tonic regulation and surge release of gonadotropin-releasing hormone/luteinizing hormone. Journal of Neuroscience 2007 27 12088–12095. (https://doi.org/10.1523/JNEUROSCI.2748-07.2007)
- 23↑
Steyn FJ, Wan Y, Clarkson J, Veldhuis JD, Herbison AE, Chen C. Development of a methodology for and assessment of pulsatile luteinizing hormone secretion in juvenile and adult male mice. Endocrinology 2013 154 4939–4945. (https://doi.org/10.1210/en.2013-1502)
- 24↑
Wakabayashi Y, Nakada T, Murata K, Ohkura S, Mogi K, Navarro VM, Clifton DK, Mori Y, Tsukamura H & Maeda K et al.Neurokinin B and dynorphin A in kisspeptin neurons of the arcuate nucleus participate in generation of periodic oscillation of neural activity driving pulsatile gonadotropin-releasing hormone secretion in the goat. Journal of Neuroscience 2010 30 3124–3132. (https://doi.org/10.1523/JNEUROSCI.5848-09.2010)
- 25↑
Minabe S, Nakamura S, Fukushima E, Sato M, Ikegami K, Goto T, Sanbo M, Hirabayashi M, Tomikawa J & Imamura T et al.Inducible Kiss1 knockdown in the hypothalamic arcuate nucleus suppressed pulsatile secretion of luteinizing hormone in male mice. Journal of Reproduction and Development 2020 66 369–375. (https://doi.org/10.1262/jrd.2019-164)
- 26↑
Nagae M, Uenoyama Y, Okamoto S, Tsuchida H, Ikegami K, Goto T, Majarune S, Nakamura S, Sanbo M & Hirabayashi M et al.Direct evidence that KNDy neurons maintain gonadotropin pulses and folliculogenesis as the GnRH pulse generator. Proceedings of the National Academy of Sciences of the United States of America 2021 118 e2009156118. (https://doi.org/10.1073/pnas.2009156118)
- 27↑
Murakawa H, Iwata K, Takeshita T, Ozawa H. Immunoelectron microscopic observation of the subcellular localization of kisspeptin, neurokinin B and dynorphin A in KNDy neurons in the arcuate nucleus of the female rat. Neuroscience Letters 2016 612 161–166. (https://doi.org/10.1016/j.neulet.2015.12.008)
- 28↑
Iwata K, Kunimura Y, Matsumoto K, Ozawa H. Effect of androgen on Kiss1 expression and luteinizing hormone release in female rats. Journal of Endocrinology 2017 233 281–292. (https://doi.org/10.1530/JOE-16-0568)
- 29↑
Minabe S, Ieda N, Watanabe Y, Inoue N, Uenoyama Y, Maeda KI, Tsukamura H. Long-term neonatal estrogen exposure causes irreversible inhibition of LH pulses by suppressing arcuate kisspeptin expression via estrogen receptors alpha and beta in female rodents. Endocrinology 2017 158 2918–2929. (https://doi.org/10.1210/en.2016-1144)
- 30↑
Minabe S, Sato M, Inoue N, Watanabe Y, Magata F, Matsuda F, Uenoyama Y, Ozawa H, Tsukamura H. Neonatal estrogen causes irreversible male infertility via specific suppressive action on hypothalamic Kiss1 neurons. Endocrinology 2019 160 1223–1233. (https://doi.org/10.1210/en.2018-00732)
- 31↑
Zhou Q, Chen H, Yang S, Li Y, Wang B, Chen Y, Wu X. High-fat diet decreases the expression of Kiss1 mRNA and kisspeptin in the ovary, and increases ovulatory dysfunction in postpubertal female rats. Reproductive Biology and Endocrinology 2014 12 127. (https://doi.org/10.1186/1477-7827-12-127)
- 32↑
Iwasa T, Matsuzaki T, Murakami M, Fujisawa S, Kinouchi R, Gereltsetseg G, Kuwahara A, Yasui T, Irahara M. Effects of intrauterine undernutrition on hypothalamic Kiss1 expression and the timing of puberty in female rats. Journal of Physiology 2010 588 821–829. (https://doi.org/10.1113/jphysiol.2009.183558)
- 33↑
Kennedy TG Evidence for a role for prostaglandins in the initiation of blastocyst implantation in the rat. Biology of Reproduction 1977 16 286–291. (https://doi.org/10.1095/biolreprod16.3.286)
- 34↑
Paxinos G & Watson C The Rat Brain in Stereotaxic Coordinates, 5th ed. Cambridge, MA, USA: Academic Press, 2007.
- 35↑
Cagampang FR, Maeda KI, Tsukamura H, Ohkura S, Ota K. Involvement of ovarian steroids and endogenous opioids in the fasting-induced suppression of pulsatile LH release in ovariectomized rats. Journal of Endocrinology 1991 129 321–328. (https://doi.org/10.1677/joe.0.1290321)
- 36↑
Takumi K, Iijima N, Iwata K, Higo S, Ozawa H. The effects of gonadal steroid manipulation on the expression of Kiss1 mRNA in rat arcuate nucleus during postnatal development. Journal of Physiological Sciences 2012 62 453–460. (https://doi.org/10.1007/s12576-012-0222-y)
- 37↑
Enomoto H, Iwata K, Matsumoto K, Otsuka M, Morita A, Ozawa H. Hypothalamic KNDy neuron expression in streptozotocin-induced diabetic female rats. Journal of Endocrinology 2022 253 39–51. (https://doi.org/10.1530/JOE-21-0169)
- 38↑
Minabe S, Iwata K, Tsuchida H, Tsukamura H, Ozawa H. Effect of diet-induced obesity on Kiss1/Tac3/Pdyn gene expressions in the arcuate nucleus and luteinizing hormone secretion in sex hormone-primed male and female rats. Peptides 2021 142 170546. (https://doi.org/10.1016/j.peptides.2021.170546)
- 39↑
Kunimura Y, Iwata K, Ishigami A, Ozawa H. Age-related alterations in hypothalamic kisspeptin, neurokinin B, and dynorphin neurons and in pulsatile LH release in female and male rats. Neurobiology of Aging 2017 50 30–38. (https://doi.org/10.1016/j.neurobiolaging.2016.10.018)
- 40↑
Takase K, Uenoyama Y, Inoue N, Matsui H, Yamada S, Shimizu M, Homma T, Tomikawa J, Kanda S & Matsumoto H et al.Possible role of oestrogen in pubertal increase of Kiss1/kisspeptin expression in discrete hypothalamic areas of female rats. Journal of Neuroendocrinology 2009 21 527–537. (https://doi.org/10.1111/j.1365-2826.2009.01868.x)
- 41↑
Merriam GR, Wachter KW. Algorithms for the study of episodic hormone secretion. American Journal of Physiology 1982 243 E310–E318. (https://doi.org/10.1152/ajpendo.1982.243.4.E310)
- 42↑
Hales CN, Barker DJ. Type 2 (non-insulin-dependent) diabetes mellitus: the thrifty phenotype hypothesis. Diabetologia 1992 35 595–601. (https://doi.org/10.1007/BF00400248)
- 43↑
Navarro VM, Ruiz-Pino F, Sanchez-Garrido MA, García-Galiano D, Hobbs SJ, Manfredi-Lozano M, León S, Sangiao-Alvarellos S, Castellano JM & Clifton DK et al.Role of neurokinin B in the control of female puberty and its modulation by metabolic status. Journal of Neuroscience 2012 32 2388–2397. (https://doi.org/10.1523/JNEUROSCI.4288-11.2012)
- 44↑
Nakahara T, Uenoyama Y, Iwase A, Oishi S, Nakamura S, Minabe S, Watanabe Y, Deura C, Noguchi T & Fujii N et al.Chronic peripheral administration of kappa-opioid receptor antagonist advances puberty onset associated with acceleration of pulsatile luteinizing hormone secretion in female rats. Journal of Reproduction and Development 2013 59 479–484. (https://doi.org/10.1262/jrd.2013-046)
- 45↑
Li XF, Lin YS, Kinsey-Jones JS, O'Byrne KT. High-fat diet increases LH pulse frequency and kisspeptin-neurokinin B expression in puberty-advanced female rats. Endocrinology 2012 153 4422–4431. (https://doi.org/10.1210/en.2012-1223)
- 46↑
Desai M, Gayle D, Babu J, Ross MG. Programmed obesity in intrauterine growth-restricted newborns: modulation by newborn nutrition. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 2005 288 R91–R96. (https://doi.org/10.1152/ajpregu.00340.2004)
- 47↑
Chan YM, Broder-Fingert S, Wong KM, Seminara SB. Kisspeptin/Gpr54-independent gonadotrophin-releasing hormone activity in Kiss1 and Gpr54 mutant mice. Journal of Neuroendocrinology 2009 21 1015–1023. (https://doi.org/10.1111/j.1365-2826.2009.01926.x)
- 48↑
Mayer C, Boehm U. Female reproductive maturation in the absence of kisspeptin/GPR54 signaling. Nature Neuroscience 2011 14 704–710. (https://doi.org/10.1038/nn.2818)
- 49↑
Chisholm JS, Ellison PT, Evans J, Lee PC, Lieberman LS, Pavlik Z, Ryan AS, Salter EM, Stini WA, Worthman CM. Death, hope, and sex: life-history theory and the development of reproductive strategies. Current Anthropology 1993 34 1–24. (https://doi.org/10.1086/204131)
- 50↑
Cooper C, Kuh D, Egger P, Wadsworth M, Barker D. Childhood growth and age at menarche. British Journal of Obstetrics and Gynaecology 1996 103 814–817. (https://doi.org/10.1111/j.1471-0528.1996.tb09879.x)
- 51↑
Preece MA Puberty in children with intrauterine growth retardation. Hormone Research 1997 48(Supplement 1) 30–32. (https://doi.org/10.1159/000191264)
- 52↑
Ibanez L, Ferrer A, Marcos MV, Hierro FR, de Zegher F. Early puberty: rapid progression and reduced final height in girls with low birth weight. Pediatrics 2000 106 E72. (https://doi.org/10.1542/peds.106.5.e72)
- 53↑
Sloboda DM, Hart R, Doherty DA, Pennell CE, Hickey M. Age at menarche: influences of prenatal and postnatal growth. Journal of Clinical Endocrinology and Metabolism 2007 92 46–50. (https://doi.org/10.1210/jc.2006-1378)