Growth hormone upregulates the pro-tumorigenic galectin 1 in mouse liver

in Endocrine Connections
View More View Less
  • 1 Departamento de Química Biológica, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Consejo Nacional de Investigaciones Científicas y Técnicas, Instituto de Química y Fisicoquímica Biológicas, Buenos Aires, Argentina
  • 2 Department of Internal Medicine, Geriatrics Research, Southern Illinois University School of Medicine, Springfield, Illinois, USA
  • 3 Laboratorio de Inmunopatología, Instituto de Biología y Medicina Experimental, Consejo Nacional de Investigaciones Científicas y Técnicas, and Departamento de Química Biológica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires, Argentina

Correspondence should be addressed to M F Troncoso or J G Miquet: fernanda@qb.ffyb.uba.ar or jmiquet@qb.ffyb.uba.ar

*(M L Bacigalupo and V G Piazza contributed equally to this work)

(M F Troncoso and J G Miquet contributed equally as co-senior authors)

The authors and journal apologise for an error in the above paper, which appeared in volume 8 part 8, pages 1108–1117. The error relates to the Cyclophilin A R primer given on page 1110.

The original article stated:

Cyclophilin A … R: TCAGCCTGGTCAAAGGTGAT’

This should have stated:

Cyclophilin A … R: AAGTCACCACCCTGGCAC’