Filter

Refine by collections

Refine by date

—
  • Print
  • Save

Search Results

You are looking at 1 - 10 of 136 items for :

  • real-world evidence x
Clear All
Alicia Romano Department of Pediatrics, New York Medical College, Valhalla, New York, USA

Search for other papers by Alicia Romano in
Google Scholar
PubMed Close
,
Juan Pablo Kaski Centre for Inherited Cardiovascular Diseases, Great Ormond Street Hospital & UCL Institute of Cardiovascular Science, London, UK

Search for other papers by Juan Pablo Kaski in
Google Scholar
PubMed Close
,
Jovanna Dahlgren Department of Paediatrics, Region Västra Götaland, Sahlgrenska University Hospital, Gothenburg, Sweden

Search for other papers by Jovanna Dahlgren in
Google Scholar
PubMed Close
,
Nicky Kelepouris US Medical Affairs, Novo Nordisk Inc., Plainsboro, New Jersey, USA

Search for other papers by Nicky Kelepouris in
Google Scholar
PubMed Close
,
Alberto Pietropoli Global Medical Affairs, Novo Nordisk Health Care AG, Zurich, Switzerland

Search for other papers by Alberto Pietropoli in
Google Scholar
PubMed Close
,
Tilman R Rohrer Department of Pediatric Endocrinology, University Children’s Hospital, Saarland University Medical Center, Homburg, Germany

Search for other papers by Tilman R Rohrer in
Google Scholar
PubMed Close
, and
Michel Polak Paediatric Endocrinology, Diabetology and Gynaecology Department, Hôpital Universitaire Necker Enfants-Malades, AP-HP, Université de Paris, Imagine Institute, Paris, France

Search for other papers by Michel Polak in
Google Scholar
PubMed Close

observational studies. Materials and methods Study design and ethics The NordiNet® International Outcomes Study (IOS; NCT00960128) and ANSWER Program (NCT01009905) were observational, multicentre studies monitoring the real-world long-term outcomes

Article Type:
Research Article
Collections:
Cardiovascular
DOI:
https://doi.org/10.1530/EC-21-0549
Volume/Issue:
Volume 11: Issue 1
Open access
Rama Lakshman Wellcome-MRC Institute of Metabolic Science, Addenbrooke's Hospital, Cambridge, UK

Search for other papers by Rama Lakshman in
Google Scholar
PubMed Close
,
Charlotte Boughton Wellcome-MRC Institute of Metabolic Science, Addenbrooke's Hospital, Cambridge, UK
Cambridge University Hospitals NHS Foundation Trust, Wolfson Diabetes and Endocrine Clinic, Cambridge, UK

Search for other papers by Charlotte Boughton in
Google Scholar
PubMed Close
, and
Roman Hovorka Wellcome-MRC Institute of Metabolic Science, Addenbrooke's Hospital, Cambridge, UK

Search for other papers by Roman Hovorka in
Google Scholar
PubMed Close

Shin J & Cohen O . Comparison of MiniMed 780G system performance in users aged younger and older than 15 years: evidence from 12 870 real-world users . Diabetes, Obesity and Metabolism 2022 24 1370 – 1379 . ( https://doi.org/10.1111/dom.14714

Article Type:
Review Article
Collections:
Metabolic Syndrome and Diabetes
DOI:
https://doi.org/10.1530/EC-23-0132
Volume/Issue:
Volume 12: Issue 8
Open access
Bogumila Urgatz Merck Healthcare KGaA, Darmstadt, Germany

Search for other papers by Bogumila Urgatz in
Google Scholar
PubMed Close
and
Kris G Poppe University Hospital CHU Saint Pierre, Free University of Brussels, Brussels, Belgium

Search for other papers by Kris G Poppe in
Google Scholar
PubMed Close

+ ( 46 ). Real world practice An analysis from a primary care database in the UK showed that TSH was higher than the first-trimester guideline goal of 2.5 μIU/mL for 46% of 1,013 pregnancies in women who had been taking LT4 for at least 6 months

Article Type:
Review Article
Collections:
Thyroid
DOI:
https://doi.org/10.1530/EC-23-0420
Volume/Issue:
Volume 13: Issue 3
Open access
Xinge Tao Department of Endocrinology and Diabetes, The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China

Search for other papers by Xinge Tao in
Google Scholar
PubMed Close
,
Yanbin Xue Computer Net Center, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for other papers by Yanbin Xue in
Google Scholar
PubMed Close
,
Rui Niu Department of Endocrinology and Diabetes, The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China

Search for other papers by Rui Niu in
Google Scholar
PubMed Close
,
Wenjing Lu Department of Endocrinology and Diabetes, The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China

Search for other papers by Wenjing Lu in
Google Scholar
PubMed Close
,
Huayan Yao Computer Net Center, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for other papers by Huayan Yao in
Google Scholar
PubMed Close
,
Chunmei He Department of Endocrinology and Diabetes, The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China

Search for other papers by Chunmei He in
Google Scholar
PubMed Close
,
Bin Cui Department of Endocrine and Metabolic Diseases, Shanghai Institute of Endocrine and Metabolic Diseases, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for other papers by Bin Cui in
Google Scholar
PubMed Close
, and
Changqin Liu Department of Endocrinology and Diabetes, The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China
Xiamen Key Laboratory for Clinical Efficacy and Evidence-Based Research of Traditional Chinese Medicine, the First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China
Fujian Province Key Laboratory of Diabetes Translational Medicine, The First Affiliated Hospital of Xiamen University, School of medicine, Xiamen University, Xiamen, China

Search for other papers by Changqin Liu in
Google Scholar
PubMed Close

Database (SHLD) to provide new real-world evidence for the management and therapy of T2DM. Methods Data source Data in this study were extracted from SHLD, which included electronic health records (EHRs) for patients from 37 tertiary hospitals

Article Type:
Research Article
Collections:
Metabolic Syndrome and Diabetes
DOI:
https://doi.org/10.1530/EC-23-0474
Volume/Issue:
Volume 13: Issue 2
Open access
Nella Augusta Greggio Endocrinology and Adolescence Unit, Department of Woman and Child Health, University of Padova, Padova, Italy

Search for other papers by Nella Augusta Greggio in
Google Scholar
PubMed Close
,
Elisa Rossi CINECA – Interuniversity Consortium (Health Service), Bologna, Italy

Search for other papers by Elisa Rossi in
Google Scholar
PubMed Close
,
Silvia Calabria CORE srl – Collaborative Outcome Research, Bologna, Italy

Search for other papers by Silvia Calabria in
Google Scholar
PubMed Close
,
Alice Meneghin Endocrinology and Adolescence Unit, Department of Woman and Child Health, University of Padova, Padova, Italy

Search for other papers by Alice Meneghin in
Google Scholar
PubMed Close
,
Joaquin Gutierrez de Rubalcava Endocrinology and Adolescence Unit, Department of Woman and Child Health, University of Padova, Padova, Italy

Search for other papers by Joaquin Gutierrez de Rubalcava in
Google Scholar
PubMed Close
,
Carlo Piccinni CORE srl – Collaborative Outcome Research, Bologna, Italy

Search for other papers by Carlo Piccinni in
Google Scholar
PubMed Close
, and
Antonella Pedrini CORE srl – Collaborative Outcome Research, Bologna, Italy

Search for other papers by Antonella Pedrini in
Google Scholar
PubMed Close

paediatric population, the fact remains that the adverse effects of therapy with levothyroxine in this special population are not known ( 28 , 29 ). In this scenario, it becomes essential to provide real-world evidence on SH in paediatric population

Article Type:
Research Article
DOI:
https://doi.org/10.1530/EC-17-0066
Volume/Issue:
Volume 6: Issue 6
Open access
Giuseppe Lisco Interdisciplinary Department of Medicine, Section of Internal Medicine, Geriatrics, Endocrinology and Rare Diseases, School of Medicine, University of Bari “Aldo Moro”, Piazza Giulio Cesare, Bari, Italy

Search for other papers by Giuseppe Lisco in
Google Scholar
PubMed Close
,
Anna De Tullio Interdisciplinary Department of Medicine, Section of Internal Medicine, Geriatrics, Endocrinology and Rare Diseases, School of Medicine, University of Bari “Aldo Moro”, Piazza Giulio Cesare, Bari, Italy

Search for other papers by Anna De Tullio in
Google Scholar
PubMed Close
,
Olga Disoteo Diabetology Unit, ASST Grande Ospedale Metropolitano Niguarda, Milan, Italy

Search for other papers by Olga Disoteo in
Google Scholar
PubMed Close
,
Giuseppina Piazzolla Interdisciplinary Department of Medicine, Section of Internal Medicine, Geriatrics, Endocrinology and Rare Diseases, School of Medicine, University of Bari “Aldo Moro”, Piazza Giulio Cesare, Bari, Italy

Search for other papers by Giuseppina Piazzolla in
Google Scholar
PubMed Close
,
Edoardo Guastamacchia Interdisciplinary Department of Medicine, Section of Internal Medicine, Geriatrics, Endocrinology and Rare Diseases, School of Medicine, University of Bari “Aldo Moro”, Piazza Giulio Cesare, Bari, Italy

Search for other papers by Edoardo Guastamacchia in
Google Scholar
PubMed Close
,
Carlo Sabbà Interdisciplinary Department of Medicine, Section of Internal Medicine, Geriatrics, Endocrinology and Rare Diseases, School of Medicine, University of Bari “Aldo Moro”, Piazza Giulio Cesare, Bari, Italy

Search for other papers by Carlo Sabbà in
Google Scholar
PubMed Close
,
Vincenzo De Geronimo Unit of Endocrinology, Policlinico Morgagni CCD, Catania, Italy

Search for other papers by Vincenzo De Geronimo in
Google Scholar
PubMed Close
,
Enrico Papini Department of Endocrinology and Metabolism, Regina Apostolorum Hospital, Rome, Italy

Search for other papers by Enrico Papini in
Google Scholar
PubMed Close
, and
Vincenzo Triggiani Interdisciplinary Department of Medicine, Section of Internal Medicine, Geriatrics, Endocrinology and Rare Diseases, School of Medicine, University of Bari “Aldo Moro”, Piazza Giulio Cesare, Bari, Italy

Search for other papers by Vincenzo Triggiani in
Google Scholar
PubMed Close

. The study further highlights the issue beyond previously published data from real-world evidence on the oncology safety of GLP-1RAs ( 41 ). However, data should be read cautiously ( 42 ). First, the risk and benefits should always be addressed and

Article Type:
Review Article
Collections:
Thyroid
DOI:
https://doi.org/10.1530/EC-23-0257
Volume/Issue:
Volume 12: Issue 11
Open access
Henry Zelada Division of Endocrinology, Diabetes and Metabolism, University of Alabama at Birmingham Heersink School of Medicine, Birmingham, Alabama, USA

Search for other papers by Henry Zelada in
Google Scholar
PubMed Close
,
M Citlalli Perez-Guzman Internal Medicine Division of Endocrinology, Centro Médico ABC, Mexico City, Mexico

Search for other papers by M Citlalli Perez-Guzman in
Google Scholar
PubMed Close
,
Daniel R Chernavvsky Center for Diabetes Technology, University of Virginia, Charlottesville, Virginia, USA

Search for other papers by Daniel R Chernavvsky in
Google Scholar
PubMed Close
, and
Rodolfo J Galindo Division of Endocrinology, Diabetes and Metabolism, University of Miami Miller School of Medicine. Miami, Florida, USA

Search for other papers by Rodolfo J Galindo in
Google Scholar
PubMed Close

use CGM. The first hospitals in the US to start using CGM were in New York City, where the pandemic was hitting the hardest. Soon after, other institutions started using CGM, implementing new protocols, and analyzing their real-world evidence (RWE

Article Type:
Review Article
Collections:
Metabolic Syndrome and Diabetes
DOI:
https://doi.org/10.1530/EC-23-0180
Volume/Issue:
Volume 12: Issue 10
Open access
Xuhua Mao Department of Clinical Laboratory, Yixing People’s Hospital, Yixing, Wuxi, Jiangsu, China

Search for other papers by Xuhua Mao in
Google Scholar
PubMed Close
,
Hucheng Chen Department of Nuclear Medicine, Nanjing Hospital Affiliated to Nanjing Medical University, Nanjing, Jiangsu, China

Search for other papers by Hucheng Chen in
Google Scholar
PubMed Close
,
Junmin Tang Department of Clinical Laboratory, Yixing People’s Hospital, Yixing, Wuxi, Jiangsu, China

Search for other papers by Junmin Tang in
Google Scholar
PubMed Close
,
Liangliang Wang Department of Neurology, Yixing People’s Hospital Affiliated to Jiangsu University, Yixing, Wuxi, Jiangsu, China

Search for other papers by Liangliang Wang in
Google Scholar
PubMed Close
, and
Tingting Shu Department of Central Laboratory, Jiangsu Province Official Hospital, Nanjing, Jiangsu, China

Search for other papers by Tingting Shu in
Google Scholar
PubMed Close

Primer sequences for real-time RT-PCR. Primers Sequence (5′→3′) Pdx-1 promoter Forward: GGTACCGGTACCTCCAGTATCAGG Reverse: CTCGAGGAGCTACAAGCCAGGCCT Pdx-1 real-time PCR Forward: TAGGCGTCGCACAAGAAGAA Reverse

Article Type:
Research Article
DOI:
https://doi.org/10.1530/EC-16-0115
Volume/Issue:
Volume 6: Issue 3
Open access
Muhammad Fahad Arshad Department of Diabetes and Endocrinology, Sheffield Teaching Hospitals, Sheffield, UK
Department of Oncology and Metabolism, The Medical School, The University of Sheffield, Sheffield, UK

Search for other papers by Muhammad Fahad Arshad in
Google Scholar
PubMed Close
,
Ahmed Iqbal Department of Diabetes and Endocrinology, Sheffield Teaching Hospitals, Sheffield, UK
Department of Oncology and Metabolism, The Medical School, The University of Sheffield, Sheffield, UK

Search for other papers by Ahmed Iqbal in
Google Scholar
PubMed Close
,
James Weeks Department of Diabetes and Endocrinology, Sheffield Teaching Hospitals, Sheffield, UK

Search for other papers by James Weeks in
Google Scholar
PubMed Close
,
Ines Fonseca Department of Diabetes and Endocrinology, Sheffield Teaching Hospitals, Sheffield, UK

Search for other papers by Ines Fonseca in
Google Scholar
PubMed Close
,
Alia Munir Department of Diabetes and Endocrinology, Sheffield Teaching Hospitals, Sheffield, UK

Search for other papers by Alia Munir in
Google Scholar
PubMed Close
, and
William Bennet Department of Diabetes and Endocrinology, Sheffield Teaching Hospitals, Sheffield, UK

Search for other papers by William Bennet in
Google Scholar
PubMed Close

efficacy of the ESE guidelines in a ‘real-world’ setting. Materials and methods We conducted a retrospective, observational, cohort study that examined the use of HTS for severe symptomatic hyponatraemia at Sheffield Teaching Hospitals (Northern

Article Type:
Research Article
Collections:
Pituitary and Hypothalamus
DOI:
https://doi.org/10.1530/EC-22-0007
Volume/Issue:
Volume 11: Issue 5
Open access
Xiaohui Qi Department of Endocrine and Metabolic Diseases, Shanghai Institute of Endocrine and Metabolic Diseases, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Shanghai National Clinical Research Center for Metabolic Diseases, Key Laboratory for Endocrine and Metabolic Diseases of the National Health Commission of the PR China, Shanghai Key Laboratory for Endocrine Tumor, State Key Laboratory of Medical Genomics, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for other papers by Xiaohui Qi in
Google Scholar
PubMed Close
,
Ping He Shanghai Hospital Link Center, Shanghai Hospital Development Center, Shanghai, China

Search for other papers by Ping He in
Google Scholar
PubMed Close
,
Huayan Yao Computer Net Center, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for other papers by Huayan Yao in
Google Scholar
PubMed Close
,
Huanhuan Sun Wonders Information Co. Ltd, Shanghai, China

Search for other papers by Huanhuan Sun in
Google Scholar
PubMed Close
,
Jiying Qi Department of Endocrine and Metabolic Diseases, Shanghai Institute of Endocrine and Metabolic Diseases, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Shanghai National Clinical Research Center for Metabolic Diseases, Key Laboratory for Endocrine and Metabolic Diseases of the National Health Commission of the PR China, Shanghai Key Laboratory for Endocrine Tumor, State Key Laboratory of Medical Genomics, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for other papers by Jiying Qi in
Google Scholar
PubMed Close
,
Min Cao Department of Endocrine and Metabolic Diseases, Shanghai Institute of Endocrine and Metabolic Diseases, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Shanghai National Clinical Research Center for Metabolic Diseases, Key Laboratory for Endocrine and Metabolic Diseases of the National Health Commission of the PR China, Shanghai Key Laboratory for Endocrine Tumor, State Key Laboratory of Medical Genomics, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for other papers by Min Cao in
Google Scholar
PubMed Close
,
Bin Cui Department of Endocrine and Metabolic Diseases, Shanghai Institute of Endocrine and Metabolic Diseases, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Shanghai National Clinical Research Center for Metabolic Diseases, Key Laboratory for Endocrine and Metabolic Diseases of the National Health Commission of the PR China, Shanghai Key Laboratory for Endocrine Tumor, State Key Laboratory of Medical Genomics, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for other papers by Bin Cui in
Google Scholar
PubMed Close
, and
Guang Ning Department of Endocrine and Metabolic Diseases, Shanghai Institute of Endocrine and Metabolic Diseases, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Shanghai National Clinical Research Center for Metabolic Diseases, Key Laboratory for Endocrine and Metabolic Diseases of the National Health Commission of the PR China, Shanghai Key Laboratory for Endocrine Tumor, State Key Laboratory of Medical Genomics, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for other papers by Guang Ning in
Google Scholar
PubMed Close

of insulin therapy with the risk of three subtypes of BTC using real-world data. Materials and methods Database The data used in this study were obtained from the Shanghai Hospital Link Database (SHLD). SHLD is a part of the Shanghai

Article Type:
Research Article
Collections:
Metabolic Syndrome and Diabetes
DOI:
https://doi.org/10.1530/EC-21-0546
Volume/Issue:
Volume 11: Issue 3
Open access