Search Results

You are looking at 1 - 10 of 171 items for :

Clear All
Open access

Qi Che, Xirong Xiao, Jun Xu, Miao Liu, Yongning Lu, Suying Liu and Xi Dong

cancer is often correlated with exceptional estrogen changes and estrogen-induced signaling ( 5 ). We previously verified that 17β-estradiol (E 2 ) upregulated interleukin (IL)-6 expressions in endometrial cancer, which lead to the local E 2 synthesis in

Open access

Simon Schimmack, Yongchao Yang, Klaus Felix, Markus Herbst, Yixiong Li, Miriam Schenk, Frank Bergmann, Thilo Hackert and Oliver Strobel

acute-phase protein which is produced mainly in the liver and rarely in atherosclerotic lesions, kidney, neurons and alveolar macrophages ( 7 , 8 , 9 ). CRP synthesis is triggered largely through secretion of interleukin 6 (IL-6) from macrophages and T

Open access

M A Webb, H Mani, S J Robertson, H L Waller, D R Webb, C L Edwardson, D H Bodicoat, T Yates, K Khunti and M J Davies

systemic inflammation seen within this group ( 7 , 8 ). In particular, the inflammatory cytokine IL6 has been found to be higher in women with PCOS compared with those without and further studies have reported that the higher IL6 levels directly contribute

Open access

Linfei Yang, Xiao Yu and Yongchao Yang

). Signal transducer and activator of transcription 3 (STAT3) is a crucial regulator of gene expression in response to signalling of the glycoprotein 130 (gp130) family of cytokines that includes IL-6 ( 13 ). The STAT3 signalling pathway plays a key role in

Open access

Emanuela Zaharieva, Zdravko Kamenov, Tsvetelina Velikova, Adelina Tsakova, Yosif El-Darawish and Haruki Okamura

pro-inflammatory cytokines (such as IL-1β, TNFα, interleukin 6 (IL-6) ( 13 , 14 , 15 , 16 ) and high-sensitivity C-reactive protein (hs-CRP) ( 17 )), elevated IL-18 level is a characteristic of obesity and the metabolic syndrome ( 18 , 19 , 20

Open access

Katarzyna Wyskida, Grzegorz Franik, Tomasz Wikarek, Aleksander Owczarek, Alham Delroba, Jerzy Chudek, Jerzy Sikora and Magdalena Olszanecka-Glinianowicz

IL-6 have not yet been studied during the physiological menstrual cycle. Finally, there were limited data available on the association between serum levels of ovarian steroids or gonadotrophins and plasma visfatin/NAMPT, vaspin, omentin-1, apelin-36

Open access

Clara Odilia Sailer, Sophia Julia Wiedemann, Konrad Strauss, Ingeborg Schnyder, Wiebke Kristin Fenske and Mirjam Christ-Crain

an increased inflammatory response with an increase in interleukin-6 (IL-6), interleukin-8 (IL-8) and tumor necrosis factor alpha (TNF-α) upon hypernatremia and hyperosmolality ( 8 , 9 , 10 , 11 , 12 , 13 ). Human in vivo studies investigating

Open access

Kate E Lines, Mahsa Javid, Anita A C Reed, Gerard V Walls, Mark Stevenson, Michelle Simon, Kreepa G Kooblall, Sian E Piret, Paul T Christie, Paul J Newey, Ann-Marie Mallon and Rajesh V Thakker

pituitary, no significant difference was observed in Ccne , Wnt2b , Il3ra , Tnfrsf10a , Coq7 or Dmpk expression in either male or female 129S6/SvEv mice, compared to C57BL/6 mice ( Fig. 5A and B ). However, significantly higher expression of Kras

Open access

Anna C Simcocks, Kayte A Jenkin, Lannie O’Keefe, Chrishan S Samuel, Michael L Mathai, Andrew J McAinch and Deanne H Hryciw

-γ), interleukin 1 alpha (IL-1α), interleukin 1 beta (IL-1β), monocyte chemotactic protein 1 (MCP-1), interleukin 2 (IL-2), interleukin 4 (IL-4), interleukin 5 (IL-5), interleukin 6 (IL-6), interleukin 10 (IL-10), interleukin 17 alpha (IL-17α), interleukin 18 (IL

Open access

Hong-Fa Yan, Zhao-Yu Liu, Zhi-Ang Guan and Chuang Guo

for quantification: TNFα : forward, AGCCCCCAGTCTGTATCCTT and reverse, ACAGTCCAGGTCACTGTCCC; IL-1β : forward, TTCAAATCTCGCAGCAGCAC and reverse, GTGCAGTTGTCTAATGGGAACG; IL-2 : forward, GCCCAAGCAGGCCACAGAAT and reverse, GGGCTTGTTGAGATGATGCTTTGA; IL-6