Search Results

You are looking at 1 - 10 of 65 items for :

Clear All
Open access

Piera Rizzolo, Valentina Silvestri, Virginia Valentini, Veronica Zelli, Agostino Bucalo, Ines Zanna, Simonetta Bianchi, Maria Grazia Tibiletti, Antonio Russo, Liliana Varesco, Gianluca Tedaldi, Bernardo Bonanni, Jacopo Azzollini, Siranoush Manoukian, Anna Coppa, Giuseppe Giannini, Laura Cortesi, Alessandra Viel, Marco Montagna, Paolo Peterlongo, Paolo Radice, Domenico Palli and Laura Ottini

in genes involved in estrogen biosynthesis and metabolism pathways, such as Cytochrome P450 family 17 subfamily A member 1 ( CYP17A1 ) and Cytochrome P450 family 1 subfamily B member 1 ( CYP1B1 ), may cause an increased risk of hormone-related cancers

Open access

Qiuli Liu, Lin-ang Wang, Jian Su, Dali Tong, Weihua Lan, Luofu Wang, Gaolei Liu, Jun Zhang, Victor Wei Zhang, Dianzheng Zhang, Rongrong Chen, Qingyi Zhu and Jun Jiang

. Six cytochrome P450 (CYP) enzymes including CYP11A1, CYP11B1, CYP11B2, CYP17A1, CYP19A1 and CYP21A2 are involved in the synthesis of steroid hormones. Although deficiencies of any of these enzymes can result in CAH ( 3 ), CYP21A2 deficiency (21OHD

Open access

Robert I Menzies, Xin Zhao, Linda J Mullins, John J Mullins, Carolynn Cairns, Nicola Wrobel, Donald R Dunbar, Matthew A Bailey and Christopher J Kenyon

) and 6 (ACTH) adrenal glands. Genes affecting cholesterol disposal but not directly involved in steroidogenesis were also downregulated by ACTH. Cyp27a1, Cyp7b1 and Hsd3b7 genes mediate cholesterol hydroxylation and subsequent isomerase

Open access

Arpna Sharma, Vijay Simha Baddela, Frank Becker, Dirk Dannenberger, Torsten Viergutz and Jens Vanselow

functional key genes. Whereas the transcript abundance of the fatty acid transporter CD36 was strongly upregulated by all three fatty acids ( Fig. 4 ), key transcripts of estradiol and progesterone production, CYP19A1 and HSD3B1 as well as those of

Open access

Stefan Riedl, Friedrich-Wilhelm Röhl, Walter Bonfig, Jürgen Brämswig, Annette Richter-Unruh, Susanne Fricke-Otto, Markus Bettendorf, Felix Riepe, Gernot Kriegshäuser, Eckhard Schönau, Gertrud Even, Berthold Hauffa, Helmuth-Günther Dörr, Reinhard W Holl, Klaus Mohnike and the AQUAPE CAH Study Group

Introduction Congenital adrenal hyperplasia (CAH; incidence 1 in 10–15,000) due to 21-hydroxylase deficiency (21-OH) ( CYP21A2 ; OMIM 201910) is an autosomal recessive disorder resulting in a deficient production of the steroid hormones

Open access

Masatada Watanabe, Shuji Ohno and Hiroshi Wachi

), a cAMP analog, insulin and IGF-I in the presence of serum ( 8 ). During expression of the CYP19A1 gene in human fibroblasts, of the multiple exons I in the human CYP19A1 gene ( Fig. 1A ), exon I.4 (exon 1b) was mainly selected as the 5′-UTR of

Open access

I Savchuk, M L Morvan, J P Antignac, K Gemzell-Danielsson, B Le Bizec, O Söder and K Svechnikov

, androsterone, androstanediol and DHT by the action of 5α-reductase 1 (SRD5A1), CYP17A1, the family of 3α-HSD1–4 (AKR1C1–4), 17βHSD3 and 17βHSD6 (HSD17B3, HSD17B6) ( 9 , 11 ). Recent studies have reported the presence of a backdoor pathway of DHT synthesis in

Open access

Ingeborg Brønstad, Lars Breivik, Paal Methlie, Anette S B Wolff, Eirik Bratland, Ingrid Nermoen, Kristian Løvås and Eystein S Husebye

by signs of hyperandrogenism postnatally and in adulthood, and associated with minor mutations (3) . The most common mutations in the CYP21A2 gene are derived from a non-functional pseudogene CYP21A1P (4) . Both CYP21A2 and CYP21A1P are

Open access

Luigi Laino, Silvia Majore, Nicoletta Preziosi, Barbara Grammatico, Carmelilia De Bernardo, Salvatore Scommegna, Anna Maria Rapone, Giacinto Marrocco, Irene Bottillo and Paola Grammatico

diagnostic approach for evaluation was conducted and psychological support was constantly provided to both patients and their families. The genetic analyses included the study of AR , AMH , CYP11B1 , CYP21A2 , DHH , DMRT1 , NR0B1 , NR5A1 , RSPO1

Open access

Masafumi Tetsuka and Misato Tanakadate

.3 767–788 (149) R AGGACCTGGTTGATGATGGTCT 915–894 CYP11A1 F CCCTGAAAGTGACTTGGTTCTTCA NM176644.2 1209–1232 (118) R GTCAAACTTGTCCGGACTGGAG 1326–1305 HSD3B1 F CCTTGTACACTTGTGCCCTGAG NM174343.3 640