Filter

Refine by collections

Refine by date

—
  • Print
  • Save

Search Results

You are looking at 1 - 8 of 8 items for :

Clear All
Rajae Talbi Department of Medicine, Division of Endocrinology, Diabetes, and Hypertension, Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts, USA

Search for other papers by Rajae Talbi in
Google Scholar
PubMed Close
and
Victor M Navarro Department of Medicine, Division of Endocrinology, Diabetes, and Hypertension, Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts, USA

Search for other papers by Victor M Navarro in
Google Scholar
PubMed Close

melanocortin receptors, MC3R and MC4R, with MC4R being the primary receptor mediating the metabolic action of melanocortins ( 28 , 29 ). On the other hand, the orexigenic AgRP and NPY peptides – both produced in AgRP neurons – increase food intake and decrease

Article Type:
Review Article
DOI:
https://doi.org/10.1530/EC-20-0068
Volume/Issue:
Volume 9: Issue 5
Open access
H Vlaardingerbroek Department of Pediatrics, Subdivision of Endocrinology, Erasmus University Medical Center-Sophia Children’s Hospital, Rotterdam, The Netherlands
Willem-Alexander Children’s Hospital, Department of Pediatrics, Division of Endocrinology, Leiden University Medical Center, Leiden, The Netherlands

Search for other papers by H Vlaardingerbroek in
Google Scholar
PubMed Close
,
E L T van den Akker Department of Pediatrics, Subdivision of Endocrinology, Erasmus University Medical Center-Sophia Children’s Hospital, Rotterdam, The Netherlands

Search for other papers by E L T van den Akker in
Google Scholar
PubMed Close
, and
A C S Hokken-Koelega Department of Pediatrics, Subdivision of Endocrinology, Erasmus University Medical Center-Sophia Children’s Hospital, Rotterdam, The Netherlands

Search for other papers by A C S Hokken-Koelega in
Google Scholar
PubMed Close

neurons: the first type expresses the orexigenic neuropeptide Y (NPY) and agouti-related peptide (AgRP); the second type expresses the anorexigenic proopiomelanocortin (POMC) and cocaine-amphetamine-related transcript (CART). Both these neuron types

Article Type:
Review Article
DOI:
https://doi.org/10.1530/EC-21-0111
Volume/Issue:
Volume 10: Issue 5
Open access
Clarissa Souza Barthem Laboratório de Adaptações Metabólicas, Programa de Bioquímica e Biofísica Celular, Instituto de Bioquímica Médica Leopoldo de Meis, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil

Search for other papers by Clarissa Souza Barthem in
Google Scholar
PubMed Close
,
Camila Lüdke Rossetti Laboratório de Adaptações Metabólicas, Programa de Bioquímica e Biofísica Celular, Instituto de Bioquímica Médica Leopoldo de Meis, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
Laboratório de Fisiologia Endócrina Doris Rosenthal, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil

Search for other papers by Camila Lüdke Rossetti in
Google Scholar
PubMed Close
,
Denise P Carvalho Laboratório de Fisiologia Endócrina Doris Rosenthal, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil

Search for other papers by Denise P Carvalho in
Google Scholar
PubMed Close
, and
Wagner Seixas da-Silva Laboratório de Adaptações Metabólicas, Programa de Bioquímica e Biofísica Celular, Instituto de Bioquímica Médica Leopoldo de Meis, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil

Search for other papers by Wagner Seixas da-Silva in
Google Scholar
PubMed Close

: GAATCTCGGCATCTTCCAGG Npy F: GACAGAGATATGGCAAGAGATCC NM_012614.2 148 R: CTAGGAAAAGTCAGGAGAGCAAG Agrp F: CCATATAAGCTCAGGGCACAAG NM_033650.1 93 R: GACACAGCTCAGCAACATTG Pmch F: ATTCTCCCCACATTCTCTTCG NM_012625

Article Type:
Research Article
DOI:
https://doi.org/10.1530/EC-19-0470
Volume/Issue:
Volume 8: Issue 12
Open access
Marie Oertel Division of Endocrinology and Diabetes, Department of Internal Medicine, University Hospital, University of Würzburg, Würzburg, Germany

Search for other papers by Marie Oertel in
Google Scholar
PubMed Close
,
Christian G Ziegler Division of Endocrinology and Diabetes, Department of Internal Medicine, University Hospital, University of Würzburg, Würzburg, Germany
Department of Internal Medicine III, University Hospital Carl Gustav Carus Dresden, Dresden, Germany

Search for other papers by Christian G Ziegler in
Google Scholar
PubMed Close
,
Michael Kohlhaas Comprehensive Heart Failure Center, Würzburg, Germany

Search for other papers by Michael Kohlhaas in
Google Scholar
PubMed Close
,
Alexander Nickel Comprehensive Heart Failure Center, Würzburg, Germany

Search for other papers by Alexander Nickel in
Google Scholar
PubMed Close
,
Simon Kloock Division of Endocrinology and Diabetes, Department of Internal Medicine, University Hospital, University of Würzburg, Würzburg, Germany

Search for other papers by Simon Kloock in
Google Scholar
PubMed Close
,
Christoph Maack Comprehensive Heart Failure Center, Würzburg, Germany

Search for other papers by Christoph Maack in
Google Scholar
PubMed Close
,
Vasco Sequeira Comprehensive Heart Failure Center, Würzburg, Germany

Search for other papers by Vasco Sequeira in
Google Scholar
PubMed Close
,
Martin Fassnacht Division of Endocrinology and Diabetes, Department of Internal Medicine, University Hospital, University of Würzburg, Würzburg, Germany

Search for other papers by Martin Fassnacht in
Google Scholar
PubMed Close
, and
Ulrich Dischinger Division of Endocrinology and Diabetes, Department of Internal Medicine, University Hospital, University of Würzburg, Würzburg, Germany
Comprehensive Heart Failure Center, Würzburg, Germany

Search for other papers by Ulrich Dischinger in
Google Scholar
PubMed Close

. Modified peptide YY molecule attenuates the activity of NPY/AgRP neurons and reduces food intake in male mice . Endocrinology 2019 160 2737 – 2747 . ( https://doi.org/10.1210/en.2019-00100 ) 35 Schirra J Sturm K Leicht P Arnold R Göke B

Article Type:
Research Article
Collections:
Metabolic Syndrome and Diabetes
DOI:
https://doi.org/10.1530/EC-23-0398
Volume/Issue:
Volume 13: Issue 3
Open access
Yueyuan Yang Department of Endocrinology, Renmin Hospital of Wuhan University, Wuhan, China

Search for other papers by Yueyuan Yang in
Google Scholar
PubMed Close
,
Tingting Yu Department of Radiology, Renmin Hospital of Wuhan University, Wuhan, China

Search for other papers by Tingting Yu in
Google Scholar
PubMed Close
,
Zhili Niu Department of Clinical Laboratory, Institute of translational medicine, Renmin Hospital of Wuhan University, Wuhan, China

Search for other papers by Zhili Niu in
Google Scholar
PubMed Close
, and
Ling Gao Department of Endocrinology, Renmin Hospital of Wuhan University, Wuhan, China

Search for other papers by Ling Gao in
Google Scholar
PubMed Close

marker for diagnosing T2D. Higher concentrations of uridine promote appetite and modulate ingestion behavior by stimulating agouti-related peptide/neuropeptide Y (AgRP/NPY) neurons in the hypothalamic arcuate nucleus. This induces higher caloric intake

Article Type:
Research Article
Collections:
Metabolic Syndrome and Diabetes
DOI:
https://doi.org/10.1530/EC-24-0075
Volume/Issue:
Volume 13: Issue 6
Open access
Mardia López-Alarcón Unidad de Investigación Médica en Nutrición, Hospital de Pediatría, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social, México, Mexico

Search for other papers by Mardia López-Alarcón in
Google Scholar
PubMed Close
,
Jessie N Zurita-Cruz Unidad de Investigación Médica en Nutrición, Hospital de Pediatría, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social, México, Mexico

Search for other papers by Jessie N Zurita-Cruz in
Google Scholar
PubMed Close
,
Alonso Torres-Rodríguez Escuela Española de Desarrollo Transpersonal, Madrid, España

Search for other papers by Alonso Torres-Rodríguez in
Google Scholar
PubMed Close
,
Karla Bedia-Mejía Unidad de Investigación Médica en Nutrición, Hospital de Pediatría, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social, México, Mexico

Search for other papers by Karla Bedia-Mejía in
Google Scholar
PubMed Close
,
Manuel Pérez-Güemez Unidad de Investigación Médica en Nutrición, Hospital de Pediatría, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social, México, Mexico

Search for other papers by Manuel Pérez-Güemez in
Google Scholar
PubMed Close
,
Leonel Jaramillo-Villanueva Departamento de Psiquiatría, Hospital de Pediatría, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social, México, Mexico

Search for other papers by Leonel Jaramillo-Villanueva in
Google Scholar
PubMed Close
,
Mario E Rendón-Macías Universidad Panamericana, Facultad de Ciencias de la Salud, Escuela de Medicina, México, Mexico

Search for other papers by Mario E Rendón-Macías in
Google Scholar
PubMed Close
,
Jose R Fernández Departments of Nutrition Sciences and Biostatistics, University of Alabama at Birmingham, Birmingham, Alabama, USA

Search for other papers by Jose R Fernández in
Google Scholar
PubMed Close
, and
Patricia Martínez-Maroñas Escuela Española de Desarrollo Transpersonal, Madrid, España

Search for other papers by Patricia Martínez-Maroñas in
Google Scholar
PubMed Close

-1421 ) 43 Briggs DI Enriori PJ Lemus MB Cowley MA Andrews ZB . Diet-induced obesity causes ghrelin resistance in arcuate NPY/AgRP neurons . Endocrinology 2010 4745 – 4755 . ( https://doi.org/10.1210/en.2010-0556 ) 20826561 44 Wei C

Article Type:
Research Article
DOI:
https://doi.org/10.1530/EC-19-0461
Volume/Issue:
Volume 9: Issue 2
Open access
Pravik Solanki Faculty of Medicine, Nursing and Health Sciences, Monash University, Victoria, Australia
Alfred Health, Melbourne, Victoria, Australia

Search for other papers by Pravik Solanki in
Google Scholar
PubMed Close
,
Beng Eu Prahran Market Clinic, Victoria, Australia
Department of General Practice, Melbourne Medical School, The University of Melbourne, Victoria, Australia

Search for other papers by Beng Eu in
Google Scholar
PubMed Close
,
Jeremy Smith Faculty of Science, University of Western Australia, Perth, Australia

Search for other papers by Jeremy Smith in
Google Scholar
PubMed Close
,
Carolyn Allan Hudson Institute of Medical Research, Melbourne, Victoria, Australia

Search for other papers by Carolyn Allan in
Google Scholar
PubMed Close
, and
Kevin Lee Faculty of Medicine, Nursing and Health Sciences, Monash University, Victoria, Australia

Search for other papers by Kevin Lee in
Google Scholar
PubMed Close

facilitate homeostatic regulation of GnRH pulses. Higher neuronal centres, such as the suprachiasmatic nucleus as well as proopiomelanocortin (POMC) and neuropeptide Y (NPY)/Agouti-related protein (AgRP), feed into this circuitry. Peripheral hormones and

Article Type:
Research Article
Collections:
Reproduction
DOI:
https://doi.org/10.1530/EC-23-0358
Volume/Issue:
Volume 12: Issue 12
Open access
Maximilian Bielohuby Sanofi-Aventis Deutschland GmbH, R&D, Industriepark Höchst, Frankfurt, Germany

Search for other papers by Maximilian Bielohuby in
Google Scholar
PubMed Close
,
Martin Bidlingmaier Endocrine Research Laboratories, Medizinische Klinik und Poliklinik IV, Klinikum der Universität München, Munich, Germany

Search for other papers by Martin Bidlingmaier in
Google Scholar
PubMed Close
, and
Uwe Schwahn Sanofi-Aventis Deutschland GmbH, R&D, Industriepark Höchst, Frankfurt, Germany

Search for other papers by Uwe Schwahn in
Google Scholar
PubMed Close

Blouet C Chang JK Chua S Jr. Central action of FGF19 reduces hypothalamic AGRP/NPY neuron activity and improves glucose metabolism . Molecular Metabolism 2014 3 19 – 28 . ( https://doi.org/10.1016/j.molmet.2013.10.002 ) 24567901 10.1016/j

Article Type:
Review Article
DOI:
https://doi.org/10.1530/EC-18-0035
Volume/Issue:
Volume 7: Issue 4
Open access