Taís S Assmann
Taís S Assmann
Endocrine Division, Hospital de Clínicas de Porto Alegre, Porto Alegre, Rio Grande do Sul, Brazil
Postgraduation Program in Medical Sciences: Endocrinology, Faculdade de Medicina, Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil
Search for other papers by Taís S Assmann in
Google Scholar
PubMed
Postgraduation Program in Medical Sciences: Endocrinology, Faculdade de Medicina, Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil
Search for other papers by Taís S Assmann in
Google Scholar
PubMed
Mariana Recamonde-Mendoza
Mariana Recamonde-Mendoza
Institute of Informatics, Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil
Search for other papers by Mariana Recamonde-Mendoza in
Google Scholar
PubMed
Search for other papers by Mariana Recamonde-Mendoza in
Google Scholar
PubMed
Bianca M De Souza
Bianca M De Souza
Endocrine Division, Hospital de Clínicas de Porto Alegre, Porto Alegre, Rio Grande do Sul, Brazil
Postgraduation Program in Medical Sciences: Endocrinology, Faculdade de Medicina, Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil
Search for other papers by Bianca M De Souza in
Google Scholar
PubMed
Postgraduation Program in Medical Sciences: Endocrinology, Faculdade de Medicina, Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil
Search for other papers by Bianca M De Souza in
Google Scholar
PubMed
Daisy Crispim
Daisy Crispim
Endocrine Division, Hospital de Clínicas de Porto Alegre, Porto Alegre, Rio Grande do Sul, Brazil
Postgraduation Program in Medical Sciences: Endocrinology, Faculdade de Medicina, Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil
Search for other papers by Daisy Crispim in
Google Scholar
PubMed
Postgraduation Program in Medical Sciences: Endocrinology, Faculdade de Medicina, Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil
Search for other papers by Daisy Crispim in
Google Scholar
PubMed
greater depth the functional involvement of miRNAs in T1DM, we selected those miRNAs that were consistently dysregulated in T1DM-related tissues (PBMCs, serum/plasma and pancreas) and performed bioinformatic analysis to retrieve their putative targets and
Zhengrong Jiang
Zhengrong Jiang
Department of Endocrinology, The Second affiliated Hospital of Fujian Medical University, Quanzhou, Fujian, China
Search for other papers by Zhengrong Jiang in
Google Scholar
PubMed
Search for other papers by Zhengrong Jiang in
Google Scholar
PubMed
Linghong Huang
Linghong Huang
Department of Endocrinology, The Second affiliated Hospital of Fujian Medical University, Quanzhou, Fujian, China
Search for other papers by Linghong Huang in
Google Scholar
PubMed
Search for other papers by Linghong Huang in
Google Scholar
PubMed
Lijun Chen
Lijun Chen
Department of Endocrinology, The Second affiliated Hospital of Fujian Medical University, Quanzhou, Fujian, China
Search for other papers by Lijun Chen in
Google Scholar
PubMed
Search for other papers by Lijun Chen in
Google Scholar
PubMed
Jingxiong Zhou
Jingxiong Zhou
Department of Endocrinology, The Second affiliated Hospital of Fujian Medical University, Quanzhou, Fujian, China
Search for other papers by Jingxiong Zhou in
Google Scholar
PubMed
Search for other papers by Jingxiong Zhou in
Google Scholar
PubMed
Bo Liang
Bo Liang
Department of Endocrinology, The Second affiliated Hospital of Fujian Medical University, Quanzhou, Fujian, China
Search for other papers by Bo Liang in
Google Scholar
PubMed
Search for other papers by Bo Liang in
Google Scholar
PubMed
Xuefeng Bai
Xuefeng Bai
Department of Endocrinology, The Second affiliated Hospital of Fujian Medical University, Quanzhou, Fujian, China
Search for other papers by Xuefeng Bai in
Google Scholar
PubMed
Search for other papers by Xuefeng Bai in
Google Scholar
PubMed
Lizhen Wu
Lizhen Wu
Department of Endocrinology, The Second affiliated Hospital of Fujian Medical University, Quanzhou, Fujian, China
Search for other papers by Lizhen Wu in
Google Scholar
PubMed
Search for other papers by Lizhen Wu in
Google Scholar
PubMed
Huibin Huang
Huibin Huang
Department of Endocrinology, The Second affiliated Hospital of Fujian Medical University, Quanzhou, Fujian, China
Search for other papers by Huibin Huang in
Google Scholar
PubMed
Search for other papers by Huibin Huang in
Google Scholar
PubMed
’GGGAAACTGTGGCGTGAT3’ R: 5’GAGTGGGTGTCGCTGTTGA3’ U6(HUMAN) F: 5’AGAGAAGATTAGCATGGCCCCTG3’ F, forward. R, reverse. Cell culture and transfection The aforementioned bioinformatic analysis and RT-qPCR results suggested that the
Lei Lei
Lei Lei
Department of Nephrology, The Second Hospital Affiliated to Kunming Medical University, Kunming, Yunnan, China
Search for other papers by Lei Lei in
Google Scholar
PubMed
Search for other papers by Lei Lei in
Google Scholar
PubMed
Yi-Hua Bai
Yi-Hua Bai
Department of Nephrology, The Second Hospital Affiliated to Kunming Medical University, Kunming, Yunnan, China
Search for other papers by Yi-Hua Bai in
Google Scholar
PubMed
Search for other papers by Yi-Hua Bai in
Google Scholar
PubMed
Hong-Ying Jiang
Hong-Ying Jiang
Department of Nephrology, The Second Hospital Affiliated to Kunming Medical University, Kunming, Yunnan, China
Search for other papers by Hong-Ying Jiang in
Google Scholar
PubMed
Search for other papers by Hong-Ying Jiang in
Google Scholar
PubMed
Ting He
Ting He
Department of Nephrology, The Second Hospital Affiliated to Kunming Medical University, Kunming, Yunnan, China
Search for other papers by Ting He in
Google Scholar
PubMed
Search for other papers by Ting He in
Google Scholar
PubMed
Meng Li
Meng Li
Department of Nephrology, The Second Hospital Affiliated to Kunming Medical University, Kunming, Yunnan, China
Search for other papers by Meng Li in
Google Scholar
PubMed
Search for other papers by Meng Li in
Google Scholar
PubMed
Jia-Ping Wang
Jia-Ping Wang
Department of Radiology, The Second Hospital Affiliated to Kunming Medical University, Kunming, Yunnan, China
Search for other papers by Jia-Ping Wang in
Google Scholar
PubMed
Search for other papers by Jia-Ping Wang in
Google Scholar
PubMed
N6-methyladenosine (m6A) methylation has been reported to play a role in type 2 diabetes (T2D). However, the key component of m6A methylation has not been well explored in T2D. This study investigates the biological role and the underlying mechanism of m6A methylation genes in T2D. The Gene Expression Omnibus (GEO) database combined with the m6A methylation and transcriptome data of T2D patients were used to identify m6A methylation differentially expressed genes (mMDEGs). Ingenuity pathway analysis (IPA) was used to predict T2D-related differentially expressed genes (DEGs). Gene ontology (GO) term enrichment and the Kyoto Encyclopedia of Genes and Genomes (KEGG) were used to determine the biological functions of mMDEGs. Gene set enrichment analysis (GSEA) was performed to further confirm the functional enrichment of mMDEGs and determine candidate hub genes. The least absolute shrinkage and selection operator (LASSO) regression analysis was carried out to screen for the best predictors of T2D, and RT-PCR and Western blot were used to verify the expression of the predictors. A total of 194 overlapping mMDEGs were detected. GO, KEGG, and GSEA analysis showed that mMDEGs were enriched in T2D and insulin signaling pathways, where the insulin gene (INS), the type 2 membranal glycoprotein gene (MAFA), and hexokinase 2 (HK2) gene were found. The LASSO regression analysis of candidate hub genes showed that the INS gene could be invoked as a predictive hub gene for T2D. INS, MAFA,and HK2 genes participate in the T2D disease process, but INS can better predict the occurrence of T2D.
Joakim Crona
Joakim Crona
Departments of Surgical Sciences, Medical Sciences, Uppsala University, S-751 85 Uppsala, Sweden
Search for other papers by Joakim Crona in
Google Scholar
PubMed
Search for other papers by Joakim Crona in
Google Scholar
PubMed
Alberto Delgado Verdugo
Alberto Delgado Verdugo
Departments of Surgical Sciences, Medical Sciences, Uppsala University, S-751 85 Uppsala, Sweden
Search for other papers by Alberto Delgado Verdugo in
Google Scholar
PubMed
Search for other papers by Alberto Delgado Verdugo in
Google Scholar
PubMed
Dan Granberg
Dan Granberg
Departments of Surgical Sciences, Medical Sciences, Uppsala University, S-751 85 Uppsala, Sweden
Search for other papers by Dan Granberg in
Google Scholar
PubMed
Search for other papers by Dan Granberg in
Google Scholar
PubMed
Staffan Welin
Staffan Welin
Departments of Surgical Sciences, Medical Sciences, Uppsala University, S-751 85 Uppsala, Sweden
Search for other papers by Staffan Welin in
Google Scholar
PubMed
Search for other papers by Staffan Welin in
Google Scholar
PubMed
Peter Stålberg
Peter Stålberg
Departments of Surgical Sciences, Medical Sciences, Uppsala University, S-751 85 Uppsala, Sweden
Search for other papers by Peter Stålberg in
Google Scholar
PubMed
Search for other papers by Peter Stålberg in
Google Scholar
PubMed
Per Hellman
Per Hellman
Departments of Surgical Sciences, Medical Sciences, Uppsala University, S-751 85 Uppsala, Sweden
Search for other papers by Per Hellman in
Google Scholar
PubMed
Search for other papers by Per Hellman in
Google Scholar
PubMed
Peyman Björklund
Peyman Björklund
Departments of Surgical Sciences, Medical Sciences, Uppsala University, S-751 85 Uppsala, Sweden
Search for other papers by Peyman Björklund in
Google Scholar
PubMed
Search for other papers by Peyman Björklund in
Google Scholar
PubMed
), bioinformatics analysis and, in the clinical setting, genetic consultation (19) . Due to its well-characterized genotype–phenotype correlation and the limitations imposed by existing technologies, there is a strong argument for investigating the potential use of
Tao Gao
Tao Gao
Department of General Practice, The Second Affiliated Hospital of Chongqing Medical University, Chongqing Medical University, Chongqing, China
Search for other papers by Tao Gao in
Google Scholar
PubMed
Search for other papers by Tao Gao in
Google Scholar
PubMed
Rui Liu
Rui Liu
Department of Oncology. The Second Affiliated Hospital of Chongqing Medical University, Chongqing Medical University, Chongqing, China
Search for other papers by Rui Liu in
Google Scholar
PubMed
Search for other papers by Rui Liu in
Google Scholar
PubMed
Chunli Li
Chunli Li
Institute of Life Sciences, Chongqing Medical University, Chongqing, China
Search for other papers by Chunli Li in
Google Scholar
PubMed
Search for other papers by Chunli Li in
Google Scholar
PubMed
Xinglin Chu
Xinglin Chu
Department of General Practice, The Second Affiliated Hospital of Chongqing Medical University, Chongqing Medical University, Chongqing, China
Search for other papers by Xinglin Chu in
Google Scholar
PubMed
Search for other papers by Xinglin Chu in
Google Scholar
PubMed
Qiao Guo
Qiao Guo
Department of General Practice, The Second Affiliated Hospital of Chongqing Medical University, Chongqing Medical University, Chongqing, China
Search for other papers by Qiao Guo in
Google Scholar
PubMed
Search for other papers by Qiao Guo in
Google Scholar
PubMed
Dazhi Ke
Dazhi Ke
Department of General Practice, The Second Affiliated Hospital of Chongqing Medical University, Chongqing Medical University, Chongqing, China
Search for other papers by Dazhi Ke in
Google Scholar
PubMed
Search for other papers by Dazhi Ke in
Google Scholar
PubMed
concentration for fetuin-B was 0.1 μg/mL. And the preparation and operation steps of the reagent were performed strictly in accordance with the instructions. Bioinformatics analysis Protein–protein interaction network construction The Search Tool (v
Zherui Fu
Zherui Fu
Department of Emergency, The First People’s Hospital of Xiaoshan District, Xiaoshan Affiliated Hospital of Wenzhou Medical University, Hangzhou, Zhejiang, China
Search for other papers by Zherui Fu in
Google Scholar
PubMed
Search for other papers by Zherui Fu in
Google Scholar
PubMed
Yi Lai
Yi Lai
Department of Emergency, The First People’s Hospital of Xiaoshan District, Xiaoshan Affiliated Hospital of Wenzhou Medical University, Hangzhou, Zhejiang, China
Search for other papers by Yi Lai in
Google Scholar
PubMed
Search for other papers by Yi Lai in
Google Scholar
PubMed
Qianfei Wang
Qianfei Wang
Department of Emergency, The First People’s Hospital of Xiaoshan District, Xiaoshan Affiliated Hospital of Wenzhou Medical University, Hangzhou, Zhejiang, China
Search for other papers by Qianfei Wang in
Google Scholar
PubMed
Search for other papers by Qianfei Wang in
Google Scholar
PubMed
Feng Lin
Feng Lin
Department of Orthopedics, The First People's Hospital of Xiaoshan District, Xiaoshan Affiliated Hospital of Wenzhou Medical University, Hangzhou, Zhejiang, China
Search for other papers by Feng Lin in
Google Scholar
PubMed
Search for other papers by Feng Lin in
Google Scholar
PubMed
Jiaping Fang
Jiaping Fang
Department of Emergency, The First People’s Hospital of Xiaoshan District, Xiaoshan Affiliated Hospital of Wenzhou Medical University, Hangzhou, Zhejiang, China
Search for other papers by Jiaping Fang in
Google Scholar
PubMed
Search for other papers by Jiaping Fang in
Google Scholar
PubMed
prognosis and treatment of thyroid cancer. Methods RNA-seq data and bioinformatics analysis This study used data downloaded from the TCGA database ( https://portal.gdc.cancer.gov ). RNA-seq data from the TCGA–thyroid carcinoma (THCA) project was
Xu-Ting Song
Xu-Ting Song
Key Laboratory of Animal Genetics, Breeding and Reproduction, Education Department of Heilongjiang Province, College of Animal Science and Technology
Search for other papers by Xu-Ting Song in
Google Scholar
PubMed
Search for other papers by Xu-Ting Song in
Google Scholar
PubMed
Jia-Nan Zhang
Jia-Nan Zhang
Key Laboratory of Animal Genetics, Breeding and Reproduction, Education Department of Heilongjiang Province, College of Animal Science and Technology
Search for other papers by Jia-Nan Zhang in
Google Scholar
PubMed
Search for other papers by Jia-Nan Zhang in
Google Scholar
PubMed
Duo-Wei Zhao
Duo-Wei Zhao
Key Laboratory of Animal Genetics, Breeding and Reproduction, Education Department of Heilongjiang Province, College of Animal Science and Technology
Search for other papers by Duo-Wei Zhao in
Google Scholar
PubMed
Search for other papers by Duo-Wei Zhao in
Google Scholar
PubMed
Yu-Fei Zhai
Yu-Fei Zhai
Key Laboratory of Animal Genetics, Breeding and Reproduction, Education Department of Heilongjiang Province, College of Animal Science and Technology
Search for other papers by Yu-Fei Zhai in
Google Scholar
PubMed
Search for other papers by Yu-Fei Zhai in
Google Scholar
PubMed
Qi Lu
Qi Lu
Key Laboratory of Animal Genetics, Breeding and Reproduction, Education Department of Heilongjiang Province, College of Animal Science and Technology
Search for other papers by Qi Lu in
Google Scholar
PubMed
Search for other papers by Qi Lu in
Google Scholar
PubMed
Mei-Yu Qi
Mei-Yu Qi
Institute of Animal Husbandry, Heilongjiang Academy of Agricultural Sciences, Harbin, China
Search for other papers by Mei-Yu Qi in
Google Scholar
PubMed
Search for other papers by Mei-Yu Qi in
Google Scholar
PubMed
Ming-Hai Lu
Ming-Hai Lu
Department of Animal Science, Heilongjiang State Farms Science Technology Vocational College, Harbin, China
Search for other papers by Ming-Hai Lu in
Google Scholar
PubMed
Search for other papers by Ming-Hai Lu in
Google Scholar
PubMed
Shou-Long Deng
Shou-Long Deng
CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China
Search for other papers by Shou-Long Deng in
Google Scholar
PubMed
Search for other papers by Shou-Long Deng in
Google Scholar
PubMed
Hong-Bing Han
Hong-Bing Han
Beijing Key Laboratory of Animal Genetic Improvement, China Agricultural University, Beijing, China
Search for other papers by Hong-Bing Han in
Google Scholar
PubMed
Search for other papers by Hong-Bing Han in
Google Scholar
PubMed
Xiu-Qin Yang
Xiu-Qin Yang
Key Laboratory of Animal Genetics, Breeding and Reproduction, Education Department of Heilongjiang Province, College of Animal Science and Technology
Search for other papers by Xiu-Qin Yang in
Google Scholar
PubMed
Search for other papers by Xiu-Qin Yang in
Google Scholar
PubMed
Yu-Chang Yao
Yu-Chang Yao
Key Laboratory of Animal Genetics, Breeding and Reproduction, Education Department of Heilongjiang Province, College of Animal Science and Technology
Search for other papers by Yu-Chang Yao in
Google Scholar
PubMed
Search for other papers by Yu-Chang Yao in
Google Scholar
PubMed
bioinformatics analysis of sheep IGF1 splice variants Based on GenBank and Ensemble sequences of IGF1 splice variants in different species, a conserved region was found by aligning sequences from multiple species. Considering sequence specificity and
Yao Su
Yao Su
Department of Obstetrics and Gynecology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Search for other papers by Yao Su in
Google Scholar
PubMed
Search for other papers by Yao Su in
Google Scholar
PubMed
Li Chen
Li Chen
Department of Obstetrics and Gynecology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Search for other papers by Li Chen in
Google Scholar
PubMed
Search for other papers by Li Chen in
Google Scholar
PubMed
Dong-Yao Zhang
Dong-Yao Zhang
Department of Obstetrics and Gynecology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Search for other papers by Dong-Yao Zhang in
Google Scholar
PubMed
Search for other papers by Dong-Yao Zhang in
Google Scholar
PubMed
Xu-Pei Gan
Xu-Pei Gan
Department of Obstetrics and Gynecology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Search for other papers by Xu-Pei Gan in
Google Scholar
PubMed
Search for other papers by Xu-Pei Gan in
Google Scholar
PubMed
Yan-Nan Cao
Yan-Nan Cao
Department of Obstetrics and Gynecology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Search for other papers by Yan-Nan Cao in
Google Scholar
PubMed
Search for other papers by Yan-Nan Cao in
Google Scholar
PubMed
De-Cui Cheng
De-Cui Cheng
Department of Obstetrics and Gynecology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Search for other papers by De-Cui Cheng in
Google Scholar
PubMed
Search for other papers by De-Cui Cheng in
Google Scholar
PubMed
Wen-Yu Liu
Wen-Yu Liu
Department of Obstetrics and Gynecology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Search for other papers by Wen-Yu Liu in
Google Scholar
PubMed
Search for other papers by Wen-Yu Liu in
Google Scholar
PubMed
Fei-Fei Li
Fei-Fei Li
Department of Obstetrics and Gynecology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Search for other papers by Fei-Fei Li in
Google Scholar
PubMed
Search for other papers by Fei-Fei Li in
Google Scholar
PubMed
Xian-Ming Xu
Xian-Ming Xu
Department of Obstetrics and Gynecology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Search for other papers by Xian-Ming Xu in
Google Scholar
PubMed
Search for other papers by Xian-Ming Xu in
Google Scholar
PubMed
Hong-Kun Wang
Hong-Kun Wang
Department of Obstetrics and Gynecology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
Search for other papers by Hong-Kun Wang in
Google Scholar
PubMed
Search for other papers by Hong-Kun Wang in
Google Scholar
PubMed
.5. Collection of fecal samples and the extraction, amplification, database construction, and bioinformatics analysis of fecal DNA On the same day as the OGTT was conducted, 2–3 g (or four scoops) of fresh feces were collected with a sampler, soaked in a
Tian Zhou
Tian Zhou
School of Clinical Medicine, GuiZhou Medical University, Guiyang, Guizhou, China
Department of Breast Surgery, Affiliated Hospital of Guizhou Medical University, Guiyang, Guizhou, China
Search for other papers by Tian Zhou in
Google Scholar
PubMed
Department of Breast Surgery, Affiliated Hospital of Guizhou Medical University, Guiyang, Guizhou, China
Search for other papers by Tian Zhou in
Google Scholar
PubMed
Dai-wei Zhao
Dai-wei Zhao
School of Clinical Medicine, GuiZhou Medical University, Guiyang, Guizhou, China
Department of Surgery, Second People's Hospital of Guizhou Province, Guiyang, Guizhou, China
Search for other papers by Dai-wei Zhao in
Google Scholar
PubMed
Department of Surgery, Second People's Hospital of Guizhou Province, Guiyang, Guizhou, China
Search for other papers by Dai-wei Zhao in
Google Scholar
PubMed
Ning Ma
Ning Ma
School of Clinical Medicine, GuiZhou Medical University, Guiyang, Guizhou, China
Search for other papers by Ning Ma in
Google Scholar
PubMed
Search for other papers by Ning Ma in
Google Scholar
PubMed
Xue-ying Zhu
Xue-ying Zhu
School of Clinical Medicine, GuiZhou Medical University, Guiyang, Guizhou, China
Search for other papers by Xue-ying Zhu in
Google Scholar
PubMed
Search for other papers by Xue-ying Zhu in
Google Scholar
PubMed
Xing-hong Chen
Xing-hong Chen
Department of Surgery, Second People's Hospital of Guizhou Province, Guiyang, Guizhou, China
Search for other papers by Xing-hong Chen in
Google Scholar
PubMed
Search for other papers by Xing-hong Chen in
Google Scholar
PubMed
Xue Luo
Xue Luo
Department of Breast Surgery, Affiliated Hospital of Guizhou Medical University, Guiyang, Guizhou, China
Search for other papers by Xue Luo in
Google Scholar
PubMed
Search for other papers by Xue Luo in
Google Scholar
PubMed
Song Chen
Song Chen
School of Clinical Medicine, GuiZhou Medical University, Guiyang, Guizhou, China
Search for other papers by Song Chen in
Google Scholar
PubMed
Search for other papers by Song Chen in
Google Scholar
PubMed
Qing-jun Gao
Qing-jun Gao
Department of Thyroid Surgery, Affiliated Hospital of Guizhou Medical University, Guiyang, Guizhou, China
Search for other papers by Qing-jun Gao in
Google Scholar
PubMed
Search for other papers by Qing-jun Gao in
Google Scholar
PubMed
analysis and related experimental analysis. Materials and methods Bioinformatic analysis of the Forkhead box P4 analysis of thyroid cancer Data source This study downloaded The Cancer Genome Atlas Thyroid Cancer (TCGA–THCA) dataset from the
Shikai Gui
Shikai Gui
Department of Neurosurgery, the 2nd affiliated hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi Province, China
Nanchang University, Nanchang, Jiangxi Province, China
Institute of Neuroscience, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Shikai Gui in
Google Scholar
PubMed
Nanchang University, Nanchang, Jiangxi Province, China
Institute of Neuroscience, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Shikai Gui in
Google Scholar
PubMed
Wanli Yu
Wanli Yu
Department of Neurosurgery, the 2nd affiliated hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi Province, China
Nanchang University, Nanchang, Jiangxi Province, China
Institute of Neuroscience, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Wanli Yu in
Google Scholar
PubMed
Nanchang University, Nanchang, Jiangxi Province, China
Institute of Neuroscience, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Wanli Yu in
Google Scholar
PubMed
Jiabao Xie
Jiabao Xie
Department of Neurosurgery, the 2nd affiliated hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi Province, China
Nanchang University, Nanchang, Jiangxi Province, China
Institute of Neuroscience, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Jiabao Xie in
Google Scholar
PubMed
Nanchang University, Nanchang, Jiangxi Province, China
Institute of Neuroscience, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Jiabao Xie in
Google Scholar
PubMed
Lunshan Peng
Lunshan Peng
Department of Neurosurgery, the 2nd affiliated hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi Province, China
Nanchang University, Nanchang, Jiangxi Province, China
Institute of Neuroscience, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Lunshan Peng in
Google Scholar
PubMed
Nanchang University, Nanchang, Jiangxi Province, China
Institute of Neuroscience, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Lunshan Peng in
Google Scholar
PubMed
Yuanyuan Xiong
Yuanyuan Xiong
Department of Neurosurgery, the 2nd affiliated hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi Province, China
Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Yuanyuan Xiong in
Google Scholar
PubMed
Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Yuanyuan Xiong in
Google Scholar
PubMed
Zhen Song
Zhen Song
Nanchang University, Nanchang, Jiangxi Province, China
Department of Urology, the 2nd affiliated hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Zhen Song in
Google Scholar
PubMed
Department of Urology, the 2nd affiliated hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Zhen Song in
Google Scholar
PubMed
Haitao Luo
Haitao Luo
Department of Neurosurgery, the 2nd affiliated hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Haitao Luo in
Google Scholar
PubMed
Search for other papers by Haitao Luo in
Google Scholar
PubMed
Juexian Xiao
Juexian Xiao
Department of Neurosurgery, the 2nd affiliated hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Juexian Xiao in
Google Scholar
PubMed
Search for other papers by Juexian Xiao in
Google Scholar
PubMed
Shengtao Yuan
Shengtao Yuan
Jiangsu Key Laboratory of Drug Screening, China Pharmaceutical University, Nanjing, Jiangsu Province, China
Search for other papers by Shengtao Yuan in
Google Scholar
PubMed
Search for other papers by Shengtao Yuan in
Google Scholar
PubMed
Zujue Cheng
Zujue Cheng
Department of Neurosurgery, the 2nd affiliated hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi Province, China
Nanchang University, Nanchang, Jiangxi Province, China
Institute of Neuroscience, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Zujue Cheng in
Google Scholar
PubMed
Nanchang University, Nanchang, Jiangxi Province, China
Institute of Neuroscience, Nanchang University, Nanchang, Jiangxi Province, China
Search for other papers by Zujue Cheng in
Google Scholar
PubMed
in invasive PitNETs remains poorly understood. Thus, this study aimed to address this gap by performing bioinformatics analysis to identify DEGs between invasive and non-invasive PitNETs, with a focus on SLC7A11. Immunohistochemical staining was
