Rajae Talbi
Rajae Talbi
Department of Medicine, Division of Endocrinology, Diabetes, and Hypertension, Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts, USA
Search for other papers by Rajae Talbi in
Google Scholar
PubMed
Search for other papers by Rajae Talbi in
Google Scholar
PubMed
Victor M Navarro
Victor M Navarro
Department of Medicine, Division of Endocrinology, Diabetes, and Hypertension, Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts, USA
Search for other papers by Victor M Navarro in
Google Scholar
PubMed
Search for other papers by Victor M Navarro in
Google Scholar
PubMed
neurons in the ARC that regulate hunger and satiety, suggesting the existence of a bidirectional metabolic-reproductive loop (discussed subsequently). The anorexigenic proopiomelanocortin (POMC) and orexigenic agouti-related peptide (AgRP)/neuropeptide Y
Arno Téblick
Arno Téblick
Clinical Division and Laboratory of Intensive Care Medicine, Department of Cellular and Molecular Medicine, KU Leuven, Leuven, Belgium
Search for other papers by Arno Téblick in
Google Scholar
PubMed
Search for other papers by Arno Téblick in
Google Scholar
PubMed
Ilse Vanhorebeek
Ilse Vanhorebeek
Clinical Division and Laboratory of Intensive Care Medicine, Department of Cellular and Molecular Medicine, KU Leuven, Leuven, Belgium
Search for other papers by Ilse Vanhorebeek in
Google Scholar
PubMed
Search for other papers by Ilse Vanhorebeek in
Google Scholar
PubMed
Inge Derese
Inge Derese
Clinical Division and Laboratory of Intensive Care Medicine, Department of Cellular and Molecular Medicine, KU Leuven, Leuven, Belgium
Search for other papers by Inge Derese in
Google Scholar
PubMed
Search for other papers by Inge Derese in
Google Scholar
PubMed
An Jacobs
An Jacobs
Clinical Division and Laboratory of Intensive Care Medicine, Department of Cellular and Molecular Medicine, KU Leuven, Leuven, Belgium
Search for other papers by An Jacobs in
Google Scholar
PubMed
Search for other papers by An Jacobs in
Google Scholar
PubMed
Renata Haghedooren
Renata Haghedooren
Clinical Division and Laboratory of Intensive Care Medicine, Department of Cellular and Molecular Medicine, KU Leuven, Leuven, Belgium
Search for other papers by Renata Haghedooren in
Google Scholar
PubMed
Search for other papers by Renata Haghedooren in
Google Scholar
PubMed
Sofie Maebe
Sofie Maebe
Clinical Division and Laboratory of Intensive Care Medicine, Department of Cellular and Molecular Medicine, KU Leuven, Leuven, Belgium
Search for other papers by Sofie Maebe in
Google Scholar
PubMed
Search for other papers by Sofie Maebe in
Google Scholar
PubMed
Gerdien A Zeilmaker-Roest
Gerdien A Zeilmaker-Roest
Department of Neonatal & Pediatric Intensive Care, Division of Pediatric Intensive Care, Erasmus MC – Sophia Children’s Hospital, Rotterdam, the Netherlands
Search for other papers by Gerdien A Zeilmaker-Roest in
Google Scholar
PubMed
Search for other papers by Gerdien A Zeilmaker-Roest in
Google Scholar
PubMed
Enno D Wildschut
Enno D Wildschut
Department of Neonatal & Pediatric Intensive Care, Division of Pediatric Intensive Care, Erasmus MC – Sophia Children’s Hospital, Rotterdam, the Netherlands
Search for other papers by Enno D Wildschut in
Google Scholar
PubMed
Search for other papers by Enno D Wildschut in
Google Scholar
PubMed
Lies Langouche
Lies Langouche
Clinical Division and Laboratory of Intensive Care Medicine, Department of Cellular and Molecular Medicine, KU Leuven, Leuven, Belgium
Search for other papers by Lies Langouche in
Google Scholar
PubMed
Search for other papers by Lies Langouche in
Google Scholar
PubMed
Greet Van den Berghe
Greet Van den Berghe
Clinical Division and Laboratory of Intensive Care Medicine, Department of Cellular and Molecular Medicine, KU Leuven, Leuven, Belgium
Search for other papers by Greet Van den Berghe in
Google Scholar
PubMed
Search for other papers by Greet Van den Berghe in
Google Scholar
PubMed
of the ACTH precursor, pro-opiomelanocortin (POMC) ( 1 ). Results from our mechanistic animal study suggested that during sepsis-induced critical illness, preserved hypothalamic corticotropin-releasing hormone (CRH) and arginine vasopressin (AVP
Gavin P Vinson
Gavin P Vinson
School of Biological and Chemical Sciences, Queen Mary University of London, London E1 4NS, UK
Search for other papers by Gavin P Vinson in
Google Scholar
PubMed
Search for other papers by Gavin P Vinson in
Google Scholar
PubMed
Caroline H Brennan
Caroline H Brennan
School of Biological and Chemical Sciences, Queen Mary University of London, London E1 4NS, UK
Search for other papers by Caroline H Brennan in
Google Scholar
PubMed
Search for other papers by Caroline H Brennan in
Google Scholar
PubMed
tegumental area (associated with reward responses); CRH, corticotrophin releasing hormone; POMC, proopiomelanocortin; +, stimulatory; −, inhibitory. Solid arrows show proven regulation, and dotted arrows show postulated actions. Secreted CRH is indicated in
Ren-Lei Ji
Ren-Lei Ji
Department of Anatomy, Physiology and Pharmacology, College of Veterinary Medicine, Auburn University, Auburn, Alabama, USA
Search for other papers by Ren-Lei Ji in
Google Scholar
PubMed
Search for other papers by Ren-Lei Ji in
Google Scholar
PubMed
Lu Huang
Lu Huang
State Key Laboratory of Developmental Biology of Freshwater Fish, College of Life Sciences, Hunan Normal University, Changsha, Hunan, People’s Republic of China
Search for other papers by Lu Huang in
Google Scholar
PubMed
Search for other papers by Lu Huang in
Google Scholar
PubMed
Yin Wang
Yin Wang
Department of Anatomy, Physiology and Pharmacology, College of Veterinary Medicine, Auburn University, Auburn, Alabama, USA
Search for other papers by Yin Wang in
Google Scholar
PubMed
Search for other papers by Yin Wang in
Google Scholar
PubMed
Ting Liu
Ting Liu
Department of Anatomy, Physiology and Pharmacology, College of Veterinary Medicine, Auburn University, Auburn, Alabama, USA
Search for other papers by Ting Liu in
Google Scholar
PubMed
Search for other papers by Ting Liu in
Google Scholar
PubMed
Si-Yu Fan
Si-Yu Fan
State Key Laboratory of Developmental Biology of Freshwater Fish, College of Life Sciences, Hunan Normal University, Changsha, Hunan, People’s Republic of China
Search for other papers by Si-Yu Fan in
Google Scholar
PubMed
Search for other papers by Si-Yu Fan in
Google Scholar
PubMed
Min Tao
Min Tao
Department of Anatomy, Physiology and Pharmacology, College of Veterinary Medicine, Auburn University, Auburn, Alabama, USA
State Key Laboratory of Developmental Biology of Freshwater Fish, College of Life Sciences, Hunan Normal University, Changsha, Hunan, People’s Republic of China
Search for other papers by Min Tao in
Google Scholar
PubMed
State Key Laboratory of Developmental Biology of Freshwater Fish, College of Life Sciences, Hunan Normal University, Changsha, Hunan, People’s Republic of China
Search for other papers by Min Tao in
Google Scholar
PubMed
Ya-Xiong Tao
Ya-Xiong Tao
Department of Anatomy, Physiology and Pharmacology, College of Veterinary Medicine, Auburn University, Auburn, Alabama, USA
Search for other papers by Ya-Xiong Tao in
Google Scholar
PubMed
Search for other papers by Ya-Xiong Tao in
Google Scholar
PubMed
difference from the parameter of 1:0, P < 0.001. Expression of mc3r , mc4r , mrap2a , and mrap2b in culter embryos and adults qRT-PCR was used to analyze developmental expression kinetics of pomc , agrp , mc3r , mc4r , mrap2a , and
Tatiana V Novoselova
Tatiana V Novoselova
Centre for Endocrinology, William Harvey Research Institute, Barts and the London School of Medicine, Queen Mary University of London, London, UK
Search for other papers by Tatiana V Novoselova in
Google Scholar
PubMed
Search for other papers by Tatiana V Novoselova in
Google Scholar
PubMed
Peter J King
Peter J King
Centre for Endocrinology, William Harvey Research Institute, Barts and the London School of Medicine, Queen Mary University of London, London, UK
Search for other papers by Peter J King in
Google Scholar
PubMed
Search for other papers by Peter J King in
Google Scholar
PubMed
Leonardo Guasti
Leonardo Guasti
Centre for Endocrinology, William Harvey Research Institute, Barts and the London School of Medicine, Queen Mary University of London, London, UK
Search for other papers by Leonardo Guasti in
Google Scholar
PubMed
Search for other papers by Leonardo Guasti in
Google Scholar
PubMed
Louise A Metherell
Louise A Metherell
Centre for Endocrinology, William Harvey Research Institute, Barts and the London School of Medicine, Queen Mary University of London, London, UK
Search for other papers by Louise A Metherell in
Google Scholar
PubMed
Search for other papers by Louise A Metherell in
Google Scholar
PubMed
Adrian J L Clark
Adrian J L Clark
Centre for Endocrinology, William Harvey Research Institute, Barts and the London School of Medicine, Queen Mary University of London, London, UK
Search for other papers by Adrian J L Clark in
Google Scholar
PubMed
Search for other papers by Adrian J L Clark in
Google Scholar
PubMed
Li F Chan
Li F Chan
Centre for Endocrinology, William Harvey Research Institute, Barts and the London School of Medicine, Queen Mary University of London, London, UK
Search for other papers by Li F Chan in
Google Scholar
PubMed
Search for other papers by Li F Chan in
Google Scholar
PubMed
). ACTH, a 39 amino acid peptide, is produced by cleavage of its precursor protein, pro-opiomelanocortin (POMC). Other cleavage products of POMC include α-, β-, γ-melanocyte-stimulating hormones (MSH), β-endorphin, N-terminal peptide of pro
Janko Sattler
Janko Sattler
Adrenal Steroid Group, ANZAC Research Institute, University of Sydney, Sydney, NSW, Australia
Department of Rheumatology and Clinical Immunology, Charité-University Medicine, Berlin, Germany
Search for other papers by Janko Sattler in
Google Scholar
PubMed
Department of Rheumatology and Clinical Immunology, Charité-University Medicine, Berlin, Germany
Search for other papers by Janko Sattler in
Google Scholar
PubMed
Jinwen Tu
Jinwen Tu
Adrenal Steroid Group, ANZAC Research Institute, University of Sydney, Sydney, NSW, Australia
Bone Research Program, ANZAC Research Institute, University of Sydney, Sydney, NSW, Australia
Concord Clinical School, The University of Sydney, Sydney, Australia
Search for other papers by Jinwen Tu in
Google Scholar
PubMed
Bone Research Program, ANZAC Research Institute, University of Sydney, Sydney, NSW, Australia
Concord Clinical School, The University of Sydney, Sydney, Australia
Search for other papers by Jinwen Tu in
Google Scholar
PubMed
Shihani Stoner
Shihani Stoner
Bone Research Program, ANZAC Research Institute, University of Sydney, Sydney, NSW, Australia
Search for other papers by Shihani Stoner in
Google Scholar
PubMed
Search for other papers by Shihani Stoner in
Google Scholar
PubMed
Jingbao Li
Jingbao Li
Bone Research Program, ANZAC Research Institute, University of Sydney, Sydney, NSW, Australia
Key Laboratory for Space Bioscience and Biotechnology, Institute of Special Environmental Biophysics, School of Life Sciences, Northwestern Polytechnical University, Shaanxi, China
Search for other papers by Jingbao Li in
Google Scholar
PubMed
Key Laboratory for Space Bioscience and Biotechnology, Institute of Special Environmental Biophysics, School of Life Sciences, Northwestern Polytechnical University, Shaanxi, China
Search for other papers by Jingbao Li in
Google Scholar
PubMed
Frank Buttgereit
Frank Buttgereit
Department of Rheumatology and Clinical Immunology, Charité-University Medicine, Berlin, Germany
Search for other papers by Frank Buttgereit in
Google Scholar
PubMed
Search for other papers by Frank Buttgereit in
Google Scholar
PubMed
Markus J Seibel
Markus J Seibel
Bone Research Program, ANZAC Research Institute, University of Sydney, Sydney, NSW, Australia
Concord Clinical School, The University of Sydney, Sydney, Australia
Department of Endocrinology & Metabolism, Concord Hospital, Sydney, Australia
Search for other papers by Markus J Seibel in
Google Scholar
PubMed
Concord Clinical School, The University of Sydney, Sydney, Australia
Department of Endocrinology & Metabolism, Concord Hospital, Sydney, Australia
Search for other papers by Markus J Seibel in
Google Scholar
PubMed
Hong Zhou
Hong Zhou
Bone Research Program, ANZAC Research Institute, University of Sydney, Sydney, NSW, Australia
Concord Clinical School, The University of Sydney, Sydney, Australia
Search for other papers by Hong Zhou in
Google Scholar
PubMed
Concord Clinical School, The University of Sydney, Sydney, Australia
Search for other papers by Hong Zhou in
Google Scholar
PubMed
Mark S Cooper
Mark S Cooper
Adrenal Steroid Group, ANZAC Research Institute, University of Sydney, Sydney, NSW, Australia
Concord Clinical School, The University of Sydney, Sydney, Australia
Department of Endocrinology & Metabolism, Concord Hospital, Sydney, Australia
Search for other papers by Mark S Cooper in
Google Scholar
PubMed
Concord Clinical School, The University of Sydney, Sydney, Australia
Department of Endocrinology & Metabolism, Concord Hospital, Sydney, Australia
Search for other papers by Mark S Cooper in
Google Scholar
PubMed
different genes in the pituitary. CRHR1, corticotropin-releasing hormone receptor 1; POMC proopiomelanocortin. The expression levels of various other genes involved in HPA axis activity and feedback were examined in the hypothalamus and pituitary
Ying Xu
Ying Xu
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Ying Xu in
Google Scholar
PubMed
Search for other papers by Ying Xu in
Google Scholar
PubMed
Lei Li
Lei Li
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Lei Li in
Google Scholar
PubMed
Search for other papers by Lei Li in
Google Scholar
PubMed
Jihong Zheng
Jihong Zheng
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Jihong Zheng in
Google Scholar
PubMed
Search for other papers by Jihong Zheng in
Google Scholar
PubMed
Meng Wang
Meng Wang
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Meng Wang in
Google Scholar
PubMed
Search for other papers by Meng Wang in
Google Scholar
PubMed
Bopei Jiang
Bopei Jiang
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Bopei Jiang in
Google Scholar
PubMed
Search for other papers by Bopei Jiang in
Google Scholar
PubMed
Yue Zhai
Yue Zhai
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Yue Zhai in
Google Scholar
PubMed
Search for other papers by Yue Zhai in
Google Scholar
PubMed
Liumei Lu
Liumei Lu
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Liumei Lu in
Google Scholar
PubMed
Search for other papers by Liumei Lu in
Google Scholar
PubMed
Cong Zhang
Cong Zhang
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Cong Zhang in
Google Scholar
PubMed
Search for other papers by Cong Zhang in
Google Scholar
PubMed
Zhe Kuang
Zhe Kuang
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Zhe Kuang in
Google Scholar
PubMed
Search for other papers by Zhe Kuang in
Google Scholar
PubMed
Xiaomei Yang
Xiaomei Yang
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Xiaomei Yang in
Google Scholar
PubMed
Search for other papers by Xiaomei Yang in
Google Scholar
PubMed
Li-Na Jin
Li-Na Jin
Department of Hematology, Changzheng Hospital, Naval Medical University, Shanghai, China
Search for other papers by Li-Na Jin in
Google Scholar
PubMed
Search for other papers by Li-Na Jin in
Google Scholar
PubMed
Gufa Lin
Gufa Lin
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Key Laboratory of Spine and Spinal Cord Injury Repair and Regeneration of Ministry of Education, Orthopaedic Department of Tongji Hospital, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Gufa Lin in
Google Scholar
PubMed
Key Laboratory of Spine and Spinal Cord Injury Repair and Regeneration of Ministry of Education, Orthopaedic Department of Tongji Hospital, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Gufa Lin in
Google Scholar
PubMed
Chao Zhang
Chao Zhang
Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai, China
Search for other papers by Chao Zhang in
Google Scholar
PubMed
Search for other papers by Chao Zhang in
Google Scholar
PubMed
Introduction The melanocortin receptors (MCRs), a subfamily of the seven-transmembrane class A G protein-coupled receptors, can be selectively regulated by pro-opiomelanocortin (POMC)-derived ligands (i.e. adrenocorticotrophic hormone (ACTH
H Vlaardingerbroek
H Vlaardingerbroek
Department of Pediatrics, Subdivision of Endocrinology, Erasmus University Medical Center-Sophia Children’s Hospital, Rotterdam, The Netherlands
Willem-Alexander Children’s Hospital, Department of Pediatrics, Division of Endocrinology, Leiden University Medical Center, Leiden, The Netherlands
Search for other papers by H Vlaardingerbroek in
Google Scholar
PubMed
Willem-Alexander Children’s Hospital, Department of Pediatrics, Division of Endocrinology, Leiden University Medical Center, Leiden, The Netherlands
Search for other papers by H Vlaardingerbroek in
Google Scholar
PubMed
E L T van den Akker
E L T van den Akker
Department of Pediatrics, Subdivision of Endocrinology, Erasmus University Medical Center-Sophia Children’s Hospital, Rotterdam, The Netherlands
Search for other papers by E L T van den Akker in
Google Scholar
PubMed
Search for other papers by E L T van den Akker in
Google Scholar
PubMed
A C S Hokken-Koelega
A C S Hokken-Koelega
Department of Pediatrics, Subdivision of Endocrinology, Erasmus University Medical Center-Sophia Children’s Hospital, Rotterdam, The Netherlands
Search for other papers by A C S Hokken-Koelega in
Google Scholar
PubMed
Search for other papers by A C S Hokken-Koelega in
Google Scholar
PubMed
neurons: the first type expresses the orexigenic neuropeptide Y (NPY) and agouti-related peptide (AgRP); the second type expresses the anorexigenic proopiomelanocortin (POMC) and cocaine-amphetamine-related transcript (CART). Both these neuron types
Lin Ji
Lin Ji
Department of Cell Biology & Medical Genetics, School of Medicine, Shenzhen University, Shenzhen, China
Search for other papers by Lin Ji in
Google Scholar
PubMed
Search for other papers by Lin Ji in
Google Scholar
PubMed
Huan-Tong Wu
Huan-Tong Wu
Beijing Engineering Research Center of Food Environment and Health, College of Life & Environmental Sciences, Minzu University of China, Beijing, China
Search for other papers by Huan-Tong Wu in
Google Scholar
PubMed
Search for other papers by Huan-Tong Wu in
Google Scholar
PubMed
Xiao-Yan Qin
Xiao-Yan Qin
Beijing Engineering Research Center of Food Environment and Health, College of Life & Environmental Sciences, Minzu University of China, Beijing, China
Search for other papers by Xiao-Yan Qin in
Google Scholar
PubMed
Search for other papers by Xiao-Yan Qin in
Google Scholar
PubMed
Rongfeng Lan
Rongfeng Lan
Department of Cell Biology & Medical Genetics, School of Medicine, Shenzhen University, Shenzhen, China
Search for other papers by Rongfeng Lan in
Google Scholar
PubMed
Search for other papers by Rongfeng Lan in
Google Scholar
PubMed
, promelanin-concentrating hormone, progastrin and pro-opiomelanocortin (POMC), as well as reduced levels of bioactive peptides such as insulin, adrenocorticotropic hormone (ACTH), neurotensin, cholecystokinin (CCK) and gastrin in Cpe fat /Cpe fat mice
Clarissa Souza Barthem
Clarissa Souza Barthem
Laboratório de Adaptações Metabólicas, Programa de Bioquímica e Biofísica Celular, Instituto de Bioquímica Médica Leopoldo de Meis, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
Search for other papers by Clarissa Souza Barthem in
Google Scholar
PubMed
Search for other papers by Clarissa Souza Barthem in
Google Scholar
PubMed
Camila Lüdke Rossetti
Camila Lüdke Rossetti
Laboratório de Adaptações Metabólicas, Programa de Bioquímica e Biofísica Celular, Instituto de Bioquímica Médica Leopoldo de Meis, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
Laboratório de Fisiologia Endócrina Doris Rosenthal, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
Search for other papers by Camila Lüdke Rossetti in
Google Scholar
PubMed
Laboratório de Fisiologia Endócrina Doris Rosenthal, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
Search for other papers by Camila Lüdke Rossetti in
Google Scholar
PubMed
Denise P Carvalho
Denise P Carvalho
Laboratório de Fisiologia Endócrina Doris Rosenthal, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
Search for other papers by Denise P Carvalho in
Google Scholar
PubMed
Search for other papers by Denise P Carvalho in
Google Scholar
PubMed
Wagner Seixas da-Silva
Wagner Seixas da-Silva
Laboratório de Adaptações Metabólicas, Programa de Bioquímica e Biofísica Celular, Instituto de Bioquímica Médica Leopoldo de Meis, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
Search for other papers by Wagner Seixas da-Silva in
Google Scholar
PubMed
Search for other papers by Wagner Seixas da-Silva in
Google Scholar
PubMed
F: TCCGGCTTGCACCTAGTAAA NM_022193.1 104 R: CCCCCAAAACGAGTAACAA Ppia F: GCTGTCTTTGGAACTTTGTCTG NM_017101.1 129 R: CCGCTGTCTCTTTTCGCC Pomc F: CCACTGAACATCTTCGTCCTC NM_139326.2 75 R
