Search Results

You are looking at 1 - 10 of 71 items for :

Clear All
Open access

Qi Che, Xirong Xiao, Jun Xu, Miao Liu, Yongning Lu, Suying Liu and Xi Dong

cancer is often correlated with exceptional estrogen changes and estrogen-induced signaling ( 5 ). We previously verified that 17β-estradiol (E 2 ) upregulated interleukin (IL)-6 expressions in endometrial cancer, which lead to the local E 2 synthesis in

Open access

M A Webb, H Mani, S J Robertson, H L Waller, D R Webb, C L Edwardson, D H Bodicoat, T Yates, K Khunti and M J Davies

systemic inflammation seen within this group ( 7 , 8 ). In particular, the inflammatory cytokine IL6 has been found to be higher in women with PCOS compared with those without and further studies have reported that the higher IL6 levels directly contribute

Open access

Simon Schimmack, Yongchao Yang, Klaus Felix, Markus Herbst, Yixiong Li, Miriam Schenk, Frank Bergmann, Thilo Hackert and Oliver Strobel

acute-phase protein which is produced mainly in the liver and rarely in atherosclerotic lesions, kidney, neurons and alveolar macrophages ( 7 , 8 , 9 ). CRP synthesis is triggered largely through secretion of interleukin 6 (IL-6) from macrophages and T

Open access

Linfei Yang, Xiao Yu and Yongchao Yang

). Signal transducer and activator of transcription 3 (STAT3) is a crucial regulator of gene expression in response to signalling of the glycoprotein 130 (gp130) family of cytokines that includes IL-6 ( 13 ). The STAT3 signalling pathway plays a key role in

Open access

Katarzyna Wyskida, Grzegorz Franik, Tomasz Wikarek, Aleksander Owczarek, Alham Delroba, Jerzy Chudek, Jerzy Sikora and Magdalena Olszanecka-Glinianowicz

IL-6 have not yet been studied during the physiological menstrual cycle. Finally, there were limited data available on the association between serum levels of ovarian steroids or gonadotrophins and plasma visfatin/NAMPT, vaspin, omentin-1, apelin-36

Open access

Emanuela Zaharieva, Zdravko Kamenov, Tsvetelina Velikova, Adelina Tsakova, Yosif El-Darawish and Haruki Okamura

pro-inflammatory cytokines (such as IL-1β, TNFα, interleukin 6 (IL-6) ( 13 , 14 , 15 , 16 ) and high-sensitivity C-reactive protein (hs-CRP) ( 17 )), elevated IL-18 level is a characteristic of obesity and the metabolic syndrome ( 18 , 19 , 20

Open access

Hong-Fa Yan, Zhao-Yu Liu, Zhi-Ang Guan and Chuang Guo

for quantification: TNFα : forward, AGCCCCCAGTCTGTATCCTT and reverse, ACAGTCCAGGTCACTGTCCC; IL-1β : forward, TTCAAATCTCGCAGCAGCAC and reverse, GTGCAGTTGTCTAATGGGAACG; IL-2 : forward, GCCCAAGCAGGCCACAGAAT and reverse, GGGCTTGTTGAGATGATGCTTTGA; IL-6

Open access

Nikolaj Rittig, Mads Svart, Niels Jessen, Niels Møller, Holger J Møller and Henning Grønbæk

-HR(2), Wako Chemicals GmbH, Germany) were analysed with the above standing methods and were all performed in accordance with the manufacturer’s recommendations. Serum concentrations of tumour necrosis factor alpha (TNF-α), interleukin (IL)-6 and IL-10

Open access

Clara Odilia Sailer, Sophia Julia Wiedemann, Konrad Strauss, Ingeborg Schnyder, Wiebke Kristin Fenske and Mirjam Christ-Crain

an increased inflammatory response with an increase in interleukin-6 (IL-6), interleukin-8 (IL-8) and tumor necrosis factor alpha (TNF-α) upon hypernatremia and hyperosmolality ( 8 , 9 , 10 , 11 , 12 , 13 ). Human in vivo studies investigating

Open access

Jairo Arturo Pinzón-Cortés, Angelina Perna-Chaux, Nicolás Steven Rojas-Villamizar, Angélica Díaz-Basabe, Diana Carolina Polanía-Villanueva, María Fernanda Jácome, Carlos Olimpo Mendivil, Helena Groot and Valeriano López-Segura

CCTTCCGGCCCTTTGGAAC 156 External IL-6 GGTTTTTGAATTAGTTTGATT CCCTATAAATCTTGATTTAAAAT 132 IL-6 methylated GAAATTTTTGGGTGTCGACGC AAAACTACGAACGCAAACACG 67 IL-6 unmethylated GAAATTTTTGGGTGTTGATGT AAAACTACAAACACAAACACA 67 External