Filter

Refine by collections

Refine by date

—
  • Print
  • Save

Search Results

You are looking at 1 - 10 of 24 items for :

Clear All
Fernanda A Correa Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Fernanda A Correa in
Google Scholar
PubMed Close
,
Ericka B Trarbach Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Ericka B Trarbach in
Google Scholar
PubMed Close
,
Cintia Tusset Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Cintia Tusset in
Google Scholar
PubMed Close
,
Ana Claudia Latronico Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Ana Claudia Latronico in
Google Scholar
PubMed Close
,
Luciana R Montenegro Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Luciana R Montenegro in
Google Scholar
PubMed Close
,
Luciani R Carvalho Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Luciani R Carvalho in
Google Scholar
PubMed Close
,
Marcela M Franca Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Marcela M Franca in
Google Scholar
PubMed Close
,
Aline P Otto Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Aline P Otto in
Google Scholar
PubMed Close
,
Everlayny F Costalonga Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Everlayny F Costalonga in
Google Scholar
PubMed Close
,
Vinicius N Brito Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Vinicius N Brito in
Google Scholar
PubMed Close
,
Ana Paula Abreu Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Ana Paula Abreu in
Google Scholar
PubMed Close
,
Mirian Y Nishi Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Mirian Y Nishi in
Google Scholar
PubMed Close
,
Alexander A L Jorge Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Alexander A L Jorge in
Google Scholar
PubMed Close
,
Ivo J P Arnhold Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Ivo J P Arnhold in
Google Scholar
PubMed Close
,
Yisrael Sidis Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Yisrael Sidis in
Google Scholar
PubMed Close
,
Nelly Pitteloud Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Nelly Pitteloud in
Google Scholar
PubMed Close
, and
Berenice B Mendonca Unidade de Endocrinologia do Desenvolvimento, Unidade de Endocrinologia Genética, Centre Hospitalier Universitaire Vaudois (CHUV), Division of Endocrinology, Laboratório de Hormônios e Genética Molecular LIM42

Search for other papers by Berenice B Mendonca in
Google Scholar
PubMed Close

/or Kallmann syndrome (KS), such as midline cerebral and facial defects (3) . The adenohypophyseal and olfactory placodes share a common embryological origin as they both emerge from the preplacodal field, which could explain this overlap (4) . FGFR1, a

Article Type:
Research Article
DOI:
https://doi.org/10.1530/EC-15-0015
Volume/Issue:
Volume 4: Issue 2
Open access
Wenqi Yang Center for Scientific Research and Institute of Exercise and Health, Guangzhou Sports University, Guangzhou, China
Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Wenqi Yang in
Google Scholar
PubMed Close
,
Ling Liu Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Ling Liu in
Google Scholar
PubMed Close
,
Yuan Wei Center for Scientific Research and Institute of Exercise and Health, Guangzhou Sports University, Guangzhou, China
Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Yuan Wei in
Google Scholar
PubMed Close
,
Chunlu Fang Center for Scientific Research and Institute of Exercise and Health, Guangzhou Sports University, Guangzhou, China
Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Chunlu Fang in
Google Scholar
PubMed Close
,
Fu Zhou Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Fu Zhou in
Google Scholar
PubMed Close
,
Jinbao Chen Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Jinbao Chen in
Google Scholar
PubMed Close
,
Qinghua Han Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Qinghua Han in
Google Scholar
PubMed Close
,
Meifang Huang Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Meifang Huang in
Google Scholar
PubMed Close
,
Xuan Tan Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Xuan Tan in
Google Scholar
PubMed Close
,
Qiuyue Liu Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Qiuyue Liu in
Google Scholar
PubMed Close
,
Qiang Pan Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Qiang Pan in
Google Scholar
PubMed Close
,
Lu Zhang Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Lu Zhang in
Google Scholar
PubMed Close
,
Xiaojuan Lei Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Xiaojuan Lei in
Google Scholar
PubMed Close
, and
Liangming Li Center for Scientific Research and Institute of Exercise and Health, Guangzhou Sports University, Guangzhou, China
Key Laboratory of Sports Technique, Tactics and Physical Function of General Administration of Sport of China, Scientific Research Center, Guangzhou Sport University, Guangzhou, China

Search for other papers by Liangming Li in
Google Scholar
PubMed Close

of FGF21 action. Adipose tissue-specific FGFR1 or β-klotho knockout abolishes FGF21 effects on glucose and energy regulation ( 9 , 10 ). Adiponectin, an insulin-sensitizing adipokine, has been shown as an effector of FGF21. Both acute and chronic FGF

Article Type:
Research Article
DOI:
https://doi.org/10.1530/EC-19-0034
Volume/Issue:
Volume 8: Issue 5
Open access
Zuyao Chen The First Affiliated Hospital, Institute of Clinical Medicine, Hengyang Medical School, University of South China, Hengyang, Hunan, China
The First Affiliated Hospital, Department of Otorhinolaryngology, Hengyang Medical School, University of South China, Hengyang, Hunan, China

Search for other papers by Zuyao Chen in
Google Scholar
PubMed Close
,
Xiaolin Zhong The First Affiliated Hospital, Institute of Clinical Medicine, Hengyang Medical School, University of South China, Hengyang, Hunan, China
The First Affiliated Hospital, Department of Endocrinology and Metabolism, Hengyang Medical School, University of South China, Hengyang, Hunan, China

Search for other papers by Xiaolin Zhong in
Google Scholar
PubMed Close
,
Weiqiang Tang The First Affiliated Hospital, Institute of Clinical Medicine, Hengyang Medical School, University of South China, Hengyang, Hunan, China

Search for other papers by Weiqiang Tang in
Google Scholar
PubMed Close
,
Min Xia The First Affiliated Hospital, Institute of Clinical Medicine, Hengyang Medical School, University of South China, Hengyang, Hunan, China

Search for other papers by Min Xia in
Google Scholar
PubMed Close
,
Chang Liu Department of Endocrinology and Metabolism, The First People's Hospital of Chenzhou, Chenzhou, China

Search for other papers by Chang Liu in
Google Scholar
PubMed Close
,
Yinping Guo The First Affiliated Hospital, Institute of Clinical Medicine, Hengyang Medical School, University of South China, Hengyang, Hunan, China

Search for other papers by Yinping Guo in
Google Scholar
PubMed Close
,
Yan Yi The First Affiliated Hospital, Institute of Clinical Medicine, Hengyang Medical School, University of South China, Hengyang, Hunan, China

Search for other papers by Yan Yi in
Google Scholar
PubMed Close
,
Qingshan Jiang The First Affiliated Hospital, Department of Otorhinolaryngology, Hengyang Medical School, University of South China, Hengyang, Hunan, China

Search for other papers by Qingshan Jiang in
Google Scholar
PubMed Close
,
Xuyu Zu The First Affiliated Hospital, Institute of Clinical Medicine, Hengyang Medical School, University of South China, Hengyang, Hunan, China

Search for other papers by Xuyu Zu in
Google Scholar
PubMed Close
, and
Jing Zhong The First Affiliated Hospital, Institute of Clinical Medicine, Hengyang Medical School, University of South China, Hengyang, Hunan, China

Search for other papers by Jing Zhong in
Google Scholar
PubMed Close

CATTCTTCTTGAGGCCAACAAA HMGA1 Forward CCAGTGAAGTGCCAACTCCGAAG Reverse GCCCTCCTCTTCCTCCTTCTCC FGFR1 Forward TGGAGTTAATACCACCGACAAA Reverse GATGATGATCTCCAGGTACAGG FGFR2 Forward CTAAAGGCAACCTCCGAGAATA Reverse

Article Type:
Research Article
Collections:
Thyroid
DOI:
https://doi.org/10.1530/EC-23-0014
Volume/Issue:
Volume 12: Issue 5
Open access
M I Stamou Harvard Reproductive Sciences Center, Massachusetts General Hospital, Boston, Massachusetts, USA
Department of Obstetrics and Gynecology, Division of Reproductive Endocrinology, University Regional Hospital of Patras, Rio, Greece
Mount Auburn Hospital, Harvard Medical School Teaching Hospital, Cambridge, Massachusetts, USA

Search for other papers by M I Stamou in
Google Scholar
PubMed Close
,
P Varnavas Department of Obstetrics and Gynecology, Division of Reproductive Endocrinology, University Regional Hospital of Patras, Rio, Greece

Search for other papers by P Varnavas in
Google Scholar
PubMed Close
,
L Plummer Harvard Reproductive Sciences Center, Massachusetts General Hospital, Boston, Massachusetts, USA

Search for other papers by L Plummer in
Google Scholar
PubMed Close
,
V Koika Department of Obstetrics and Gynecology, Division of Reproductive Endocrinology, University Regional Hospital of Patras, Rio, Greece

Search for other papers by V Koika in
Google Scholar
PubMed Close
, and
N A Georgopoulos Department of Obstetrics and Gynecology, Division of Reproductive Endocrinology, University Regional Hospital of Patras, Rio, Greece

Search for other papers by N A Georgopoulos in
Google Scholar
PubMed Close

such genes include ANOS1 – Anosmin 1, previously known as KAL1 – Kallmann 1, NSMF – NMDA receptor synaptonuclear signaling and neuronal migration factor, FGFR1 – fibroblast growth factor receptor 1 , FGF8 – fibroblast growth factor 8, FGF17

Article Type:
Research Article
DOI:
https://doi.org/10.1530/EC-19-0010
Volume/Issue:
Volume 8: Issue 5
Open access
Mohammed S Razzaque Department of Pathology, Lake Erie College of Osteopathic Medicine, Erie, Pennsylvania, USA

Search for other papers by Mohammed S Razzaque in
Google Scholar
PubMed Close

exert downstream signaling events ( 11 ). Studies have found that FGF23 exerts most of its physiologic functions through binding with FGFR1c ( 11 , 12 ). In renal proximal tubular epithelial cells, circulating FGF23 binds with the αKlotho/FGFR1c complex

Article Type:
Review Article
Collections:
Bone and Mineral Metabolism
DOI:
https://doi.org/10.1530/EC-22-0239
Volume/Issue:
Volume 11: Issue 10
Open access
Anna-Pauliina Iivonen Institute of Biomedicine/Physiology, Biomedicum Helsinki and Stem Cells and Metabolism Research Program, University of Helsinki, Helsinki, Finland

Search for other papers by Anna-Pauliina Iivonen in
Google Scholar
PubMed Close
,
Johanna Känsäkoski Institute of Biomedicine/Physiology, Biomedicum Helsinki and Stem Cells and Metabolism Research Program, University of Helsinki, Helsinki, Finland

Search for other papers by Johanna Känsäkoski in
Google Scholar
PubMed Close
,
Kirsi Vaaralahti Institute of Biomedicine/Physiology, Biomedicum Helsinki and Stem Cells and Metabolism Research Program, University of Helsinki, Helsinki, Finland

Search for other papers by Kirsi Vaaralahti in
Google Scholar
PubMed Close
, and
Taneli Raivio Institute of Biomedicine/Physiology, Biomedicum Helsinki and Stem Cells and Metabolism Research Program, University of Helsinki, Helsinki, Finland
New Children’s Hospital, Pediatric Research Center, Helsinki University Hospital, Helsinki, Finland

Search for other papers by Taneli Raivio in
Google Scholar
PubMed Close

the murine miR-7 predicted target genes, such as Glg1 , Ptgfrn , Sema4c and Chd3 ( 8 ) and currently known nHH/KS genes such as GNRHR , FGFR1 , SEMA7A and PROK2 (see Subjects and methods; ( 1 )). However, we found no mutations in MIR7

Article Type:
Research Article
DOI:
https://doi.org/10.1530/EC-19-0080
Volume/Issue:
Volume 8: Issue 5
Open access
Catarina I Gonçalves CICS-UBI, Health Sciences Research Centre, University of Beira Interior, Covilhã, Portugal

Search for other papers by Catarina I Gonçalves in
Google Scholar
PubMed Close
,
José M Aragüés Serviço de Endocrinologia, Diabetes e Metabolismo, Hospital de Santa Maria, Lisboa, Portugal

Search for other papers by José M Aragüés in
Google Scholar
PubMed Close
,
Margarida Bastos Serviço de Endocrinologia, Diabetes e Metabolismo, Centro Hospitalar Universitário de Coimbra, Coimbra, Portugal

Search for other papers by Margarida Bastos in
Google Scholar
PubMed Close
,
Luísa Barros Serviço de Endocrinologia, Diabetes e Metabolismo, Centro Hospitalar Universitário de Coimbra, Coimbra, Portugal

Search for other papers by Luísa Barros in
Google Scholar
PubMed Close
,
Nuno Vicente Serviço de Endocrinologia, Diabetes e Metabolismo, Centro Hospitalar Universitário de Coimbra, Coimbra, Portugal

Search for other papers by Nuno Vicente in
Google Scholar
PubMed Close
,
Davide Carvalho Serviço de Endocrinologia, Diabetes e Metabolismo, Hospital de São João e Faculdade de Medicina do Porto, Instituto de Investigação e Inovação em Saúde da Universidade do Porto, Porto, Portugal

Search for other papers by Davide Carvalho in
Google Scholar
PubMed Close
, and
Manuel C Lemos CICS-UBI, Health Sciences Research Centre, University of Beira Interior, Covilhã, Portugal

Search for other papers by Manuel C Lemos in
Google Scholar
PubMed Close

addition, this patient was screened for digenic/oligogenic mutations by sequencing additional genes related to the hypothalamic–pituitary–gonadal axis ( KAL1 , FGFR1 , GNRH1 , FGF8 , PROK2 , PROKR2 , KISS1R , CHD7 , TAC3 and TACR3 ) (all primer

Article Type:
Research Article
DOI:
https://doi.org/10.1530/EC-17-0104
Volume/Issue:
Volume 6: Issue 6
Open access
Anru Wang Department of Pediatrics, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
Department of Pediatrics, The Second Affiliated Hospital of Nanjing Medical University, Nanjing, China

Search for other papers by Anru Wang in
Google Scholar
PubMed Close
,
Xueqin Yan Department of Pediatrics, Boai Hospital of Zhongshan, Zhongshan, China

Search for other papers by Xueqin Yan in
Google Scholar
PubMed Close
,
Cai Zhang Department of Pediatrics, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

Search for other papers by Cai Zhang in
Google Scholar
PubMed Close
,
Caiqi Du Department of Pediatrics, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

Search for other papers by Caiqi Du in
Google Scholar
PubMed Close
,
Wenjun Long Department of Pediatrics, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

Search for other papers by Wenjun Long in
Google Scholar
PubMed Close
,
Di Zhan Department of Pediatrics, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

Search for other papers by Di Zhan in
Google Scholar
PubMed Close
, and
Xiaoping Luo Department of Pediatrics, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

Search for other papers by Xiaoping Luo in
Google Scholar
PubMed Close

mediates a range of biological responses including development, wound healing, homeostasis and metabolism ( 14 ). Most FGFs, called canonical FGFs, interact with heparin or heparin sulfate glycosaminoglycans (HSGAGs) and then activate FGF receptors (FGFR1

Article Type:
Research Article
DOI:
https://doi.org/10.1530/EC-18-0141
Volume/Issue:
Volume 7: Issue 8
Open access
Ja Hye Kim Department of Pediatrics, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea

Search for other papers by Ja Hye Kim in
Google Scholar
PubMed Close
,
Yunha Choi Department of Pediatrics, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea

Search for other papers by Yunha Choi in
Google Scholar
PubMed Close
,
Soojin Hwang Department of Pediatrics, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea

Search for other papers by Soojin Hwang in
Google Scholar
PubMed Close
,
Ji-Hee Yoon Department of Pediatrics, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea

Search for other papers by Ji-Hee Yoon in
Google Scholar
PubMed Close
,
Jieun Lee Department of Pediatrics, Ilsan Paik Hospital, Inje University College of Medicine, Goyang, Korea

Search for other papers by Jieun Lee in
Google Scholar
PubMed Close
,
Min Jae Kang Department of Pediatrics, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea

Search for other papers by Min Jae Kang in
Google Scholar
PubMed Close
,
Gu-Hwan Kim Medical Genetics Center, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea

Search for other papers by Gu-Hwan Kim in
Google Scholar
PubMed Close
,
Han-Wook Yoo Department of Pediatrics, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea

Search for other papers by Han-Wook Yoo in
Google Scholar
PubMed Close
, and
Jin-Ho Choi Department of Pediatrics, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea

Search for other papers by Jin-Ho Choi in
Google Scholar
PubMed Close

regulates neuronal cell function, such as neurite branching, outgrowth, and migration through the activation of FGFR1 ( 30 , 31 ), and promotes angiogenesis through vascular endothelial growth factor (VEGFR)-related signaling as well as migration ( 32

Article Type:
Research Article
Collections:
Pituitary and Hypothalamus
DOI:
https://doi.org/10.1530/EC-22-0413
Volume/Issue:
Volume 12: Issue 5
Open access
Tristan Avril Pediatric Endocrinology Department, CHU Bicetre, Assistance Publique-Hôpitaux de Paris, Reference Center for Rare Disease CRMR DevGen, Le Kremlin Bicêtre, Paris, France

Search for other papers by Tristan Avril in
Google Scholar
PubMed Close
,
Quentin Hennocq Datascience platform, Imagine Institute, Université Paris Cité, Paris, France

Search for other papers by Quentin Hennocq in
Google Scholar
PubMed Close
,
Anne-Sophie Lambert Pediatric Endocrinology Department, CHU Bicetre, Assistance Publique-Hôpitaux de Paris, Reference Center for Rare Disease CRMR DevGen, Le Kremlin Bicêtre, Paris, France

Search for other papers by Anne-Sophie Lambert in
Google Scholar
PubMed Close
,
Juliane Leger Pediatric Endocrinology Department, CHU Robert Debré, Assistance Publique-Hôpitaux de Paris, Reference Center for Rare Disease CRMR de la Croissance et du Développement, Paris, France
Université Paris Cité, Faculté de Santé, UFR de Médecine, Paris, France

Search for other papers by Juliane Leger in
Google Scholar
PubMed Close
,
Dominique Simon Pediatric Endocrinology Department, CHU Robert Debré, Assistance Publique-Hôpitaux de Paris, Reference Center for Rare Disease CRMR de la Croissance et du Développement, Paris, France

Search for other papers by Dominique Simon in
Google Scholar
PubMed Close
,
Laetitia Martinerie Pediatric Endocrinology Department, CHU Robert Debré, Assistance Publique-Hôpitaux de Paris, Reference Center for Rare Disease CRMR de la Croissance et du Développement, Paris, France
Université Paris Cité, Faculté de Santé, UFR de Médecine, Paris, France
Inserm UMR1185, Le Kremlin Bicetre, Paris, France

Search for other papers by Laetitia Martinerie in
Google Scholar
PubMed Close
, and
Claire Bouvattier Pediatric Endocrinology Department, CHU Bicetre, Assistance Publique-Hôpitaux de Paris, Reference Center for Rare Disease CRMR DevGen, Le Kremlin Bicêtre, Paris, France
Inserm UMR1185, Le Kremlin Bicetre, Paris, France
Paris-Saclay University, Paris, France

Search for other papers by Claire Bouvattier in
Google Scholar
PubMed Close

selection of the genes investigated was based on the PubMed and Orphanet bibliography (ORPHA432 and ORPHA478) and on the OMIM database. The genes investigated in the IHH were GNRHR, GNRH1, KISS1R, KISS1, TACR3, TAC3, ANOS1, FGFR1, FGF8, PROKR2, PROK2, WDR11

Article Type:
Research Article
Collections:
Reproduction
DOI:
https://doi.org/10.1530/EC-22-0252
Volume/Issue:
Volume 12: Issue 4
Open access