Chun-feng Lu
Chun-feng Lu
Department of Endocrinology, Affiliated Hospital 2 of Nantong University and First People’s Hospital of Nantong City, Nantong, China
Search for other papers by Chun-feng Lu in
Google Scholar
PubMed
Search for other papers by Chun-feng Lu in
Google Scholar
PubMed
Wang-shu Liu
Wang-shu Liu
Department of Endocrinology, Affiliated Hospital 2 of Nantong University and First People’s Hospital of Nantong City, Nantong, China
Search for other papers by Wang-shu Liu in
Google Scholar
PubMed
Search for other papers by Wang-shu Liu in
Google Scholar
PubMed
Xiao-qin Ge
Xiao-qin Ge
Department of Endocrinology, Affiliated Hospital 2 of Nantong University and First People’s Hospital of Nantong City, Nantong, China
Search for other papers by Xiao-qin Ge in
Google Scholar
PubMed
Search for other papers by Xiao-qin Ge in
Google Scholar
PubMed
Feng Xu
Feng Xu
Department of Endocrinology, Affiliated Hospital 2 of Nantong University and First People’s Hospital of Nantong City, Nantong, China
Search for other papers by Feng Xu in
Google Scholar
PubMed
Search for other papers by Feng Xu in
Google Scholar
PubMed
Jian-bin Su
Jian-bin Su
Department of Endocrinology, Affiliated Hospital 2 of Nantong University and First People’s Hospital of Nantong City, Nantong, China
Search for other papers by Jian-bin Su in
Google Scholar
PubMed
Search for other papers by Jian-bin Su in
Google Scholar
PubMed
Xue-qin Wang
Xue-qin Wang
Department of Endocrinology, Affiliated Hospital 2 of Nantong University and First People’s Hospital of Nantong City, Nantong, China
Search for other papers by Xue-qin Wang in
Google Scholar
PubMed
Search for other papers by Xue-qin Wang in
Google Scholar
PubMed
Yan Wang
Yan Wang
Department of Geriatrics, Affiliated Hospital 2 of Nantong University and First People’s Hospital of Nantong City, Nantong, China
Search for other papers by Yan Wang in
Google Scholar
PubMed
Search for other papers by Yan Wang in
Google Scholar
PubMed
interleukin-6 (IL-6), which may contribute to the exacerbation of GD ( 19 ). In this study, we found that serum ADA levels in GD patients were significantly higher than those in HC, and that serum ADA levels in GD patients were closely related to thyroid
Xiaoxia Jia
Xiaoxia Jia
Center for Metabolism and Immune Diseases, Beijing Luhe Hospital, Capital Medical University, Beijing, China
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Xiaoxia Jia in
Google Scholar
PubMed
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Xiaoxia Jia in
Google Scholar
PubMed
Yaxin An
Yaxin An
Center for Metabolism and Immune Diseases, Beijing Luhe Hospital, Capital Medical University, Beijing, China
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Yaxin An in
Google Scholar
PubMed
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Yaxin An in
Google Scholar
PubMed
Yuechao Xu
Yuechao Xu
Center for Metabolism and Immune Diseases, Beijing Luhe Hospital, Capital Medical University, Beijing, China
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Yuechao Xu in
Google Scholar
PubMed
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Yuechao Xu in
Google Scholar
PubMed
Yuxian Yang
Yuxian Yang
Center for Metabolism and Immune Diseases, Beijing Luhe Hospital, Capital Medical University, Beijing, China
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Yuxian Yang in
Google Scholar
PubMed
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Yuxian Yang in
Google Scholar
PubMed
Chang Liu
Chang Liu
Center for Metabolism and Immune Diseases, Beijing Luhe Hospital, Capital Medical University, Beijing, China
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Chang Liu in
Google Scholar
PubMed
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Chang Liu in
Google Scholar
PubMed
Dong Zhao
Dong Zhao
Center for Metabolism and Immune Diseases, Beijing Luhe Hospital, Capital Medical University, Beijing, China
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Dong Zhao in
Google Scholar
PubMed
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Dong Zhao in
Google Scholar
PubMed
Jing Ke
Jing Ke
Center for Metabolism and Immune Diseases, Beijing Luhe Hospital, Capital Medical University, Beijing, China
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Jing Ke in
Google Scholar
PubMed
Beijing Key Laboratory of Diabetes Research and Care, Beijing, China
Search for other papers by Jing Ke in
Google Scholar
PubMed
function have revealed that adipose tissue is not just an inert organ for energy storage. It expresses and secretes a variety of biologically active molecules, such as estrogen, resistin, leptin, adiponectin, and interleukin-6 (IL-6). These molecules affect
Martin Wiegand
Martin Wiegand
MRC Biostatistics Unit, School of Clinical Medicine, University of Cambridge, Cambridge, UK
Search for other papers by Martin Wiegand in
Google Scholar
PubMed
Search for other papers by Martin Wiegand in
Google Scholar
PubMed
David J Halsall
David J Halsall
Cambridge University Hospitals NHS Foundation Trust, Cambridge, UK
Search for other papers by David J Halsall in
Google Scholar
PubMed
Search for other papers by David J Halsall in
Google Scholar
PubMed
Sarah L Cowan
Sarah L Cowan
Cambridge University Hospitals NHS Foundation Trust, Cambridge, UK
Search for other papers by Sarah L Cowan in
Google Scholar
PubMed
Search for other papers by Sarah L Cowan in
Google Scholar
PubMed
Kevin Taylor
Kevin Taylor
Cambridge University Hospitals NHS Foundation Trust, Cambridge, UK
Search for other papers by Kevin Taylor in
Google Scholar
PubMed
Search for other papers by Kevin Taylor in
Google Scholar
PubMed
Robert J B Goudie
Robert J B Goudie
MRC Biostatistics Unit, School of Clinical Medicine, University of Cambridge, Cambridge, UK
Search for other papers by Robert J B Goudie in
Google Scholar
PubMed
Search for other papers by Robert J B Goudie in
Google Scholar
PubMed
Jacobus Preller
Jacobus Preller
Cambridge University Hospitals NHS Foundation Trust, Cambridge, UK
Search for other papers by Jacobus Preller in
Google Scholar
PubMed
Search for other papers by Jacobus Preller in
Google Scholar
PubMed
Mark Gurnell
Mark Gurnell
Cambridge University Hospitals NHS Foundation Trust, Cambridge, UK
Wellcome–MRC Institute of Metabolic Science, University of Cambridge and NIHR Cambridge Biomedical Research Centre, Addenbrooke’s Hospital, Cambridge, UK
Search for other papers by Mark Gurnell in
Google Scholar
PubMed
Wellcome–MRC Institute of Metabolic Science, University of Cambridge and NIHR Cambridge Biomedical Research Centre, Addenbrooke’s Hospital, Cambridge, UK
Search for other papers by Mark Gurnell in
Google Scholar
PubMed
supplementary materials given at the end of this article), although these patients had lower interleukin-6 (median 8.1 vs 11.9); were less likely to be admitted to ICU (11.2% vs 18.9%); and were more likely to have diabetes (32.8% vs 20.7%) or other endocrine
Dorte Glintborg
Dorte Glintborg
Department of Endocrinology and Metabolism, Odense University Hospital, Odense, Denmark
Search for other papers by Dorte Glintborg in
Google Scholar
PubMed
Search for other papers by Dorte Glintborg in
Google Scholar
PubMed
Magda Lambaa Altinok
Magda Lambaa Altinok
Department of Endocrinology and Metabolism, Odense University Hospital, Odense, Denmark
Search for other papers by Magda Lambaa Altinok in
Google Scholar
PubMed
Search for other papers by Magda Lambaa Altinok in
Google Scholar
PubMed
Pernille Ravn
Pernille Ravn
Department of Gynecology and Obstetrics, Odense University Hospital, Odense, Denmark
Search for other papers by Pernille Ravn in
Google Scholar
PubMed
Search for other papers by Pernille Ravn in
Google Scholar
PubMed
Kurt Bjerregaard Stage
Kurt Bjerregaard Stage
Department of Psychiatry, Odense University Hospital, Odense, Denmark
Search for other papers by Kurt Bjerregaard Stage in
Google Scholar
PubMed
Search for other papers by Kurt Bjerregaard Stage in
Google Scholar
PubMed
Kurt Højlund
Kurt Højlund
Department of Endocrinology and Metabolism, Odense University Hospital, Odense, Denmark
Search for other papers by Kurt Højlund in
Google Scholar
PubMed
Search for other papers by Kurt Højlund in
Google Scholar
PubMed
Marianne Andersen
Marianne Andersen
Department of Endocrinology and Metabolism, Odense University Hospital, Odense, Denmark
Search for other papers by Marianne Andersen in
Google Scholar
PubMed
Search for other papers by Marianne Andersen in
Google Scholar
PubMed
improved by adding measurements of free fatty acids and inflammatory markers such as adiponectin or interleukins. We included overweight and obese women with PCOS and our study results may not apply in lean women with PCOS. Furthermore, different study
Florian W Kiefer
Florian W Kiefer
Clinical Division of Endocrinology and Metabolism, Department of Medicine III, Medical University of Vienna, Vienna, Austria
Search for other papers by Florian W Kiefer in
Google Scholar
PubMed
Search for other papers by Florian W Kiefer in
Google Scholar
PubMed
by the intrinsic thermogenic activity but by endocrine factors released from the transplant. Additional support for this concept came from a study showing that the favorable metabolic effects of BAT transplantation were lost when interleukin-6 (IL-6
Davoud Jafari-Gharabaghlou
Davoud Jafari-Gharabaghlou
Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran
Department of Clinical Biochemistry and Laboratory Medicine, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Davoud Jafari-Gharabaghlou in
Google Scholar
PubMed
Department of Clinical Biochemistry and Laboratory Medicine, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Davoud Jafari-Gharabaghlou in
Google Scholar
PubMed
Mostafa Vaghari-Tabari
Mostafa Vaghari-Tabari
Department of Clinical Biochemistry and Laboratory Medicine, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Mostafa Vaghari-Tabari in
Google Scholar
PubMed
Search for other papers by Mostafa Vaghari-Tabari in
Google Scholar
PubMed
Hajar Oghbaei
Hajar Oghbaei
Department of Physiology, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Hajar Oghbaei in
Google Scholar
PubMed
Search for other papers by Hajar Oghbaei in
Google Scholar
PubMed
Laura Lotz
Laura Lotz
Department of Obstetrics and Gynecology, Erlangen University Hospital, Friedrich-Alexander University of Erlangen–Nürnberg, Erlangen, Germany
Search for other papers by Laura Lotz in
Google Scholar
PubMed
Search for other papers by Laura Lotz in
Google Scholar
PubMed
Reza Zarezadeh
Reza Zarezadeh
Department of Clinical Biochemistry and Laboratory Medicine, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Reza Zarezadeh in
Google Scholar
PubMed
Search for other papers by Reza Zarezadeh in
Google Scholar
PubMed
Yeganeh Rastgar Rezaei
Yeganeh Rastgar Rezaei
Department of Medical Biotechnology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Yeganeh Rastgar Rezaei in
Google Scholar
PubMed
Search for other papers by Yeganeh Rastgar Rezaei in
Google Scholar
PubMed
Mahnaz Ranjkesh
Mahnaz Ranjkesh
Medical Radiation Science Research Group (MRSRG), Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Mahnaz Ranjkesh in
Google Scholar
PubMed
Search for other papers by Mahnaz Ranjkesh in
Google Scholar
PubMed
Mohammad Nouri
Mohammad Nouri
Department of Clinical Biochemistry and Laboratory Medicine, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
Department of Reproductive Biology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Mohammad Nouri in
Google Scholar
PubMed
Department of Reproductive Biology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Mohammad Nouri in
Google Scholar
PubMed
Amir Fattahi
Amir Fattahi
Department of Obstetrics and Gynecology, Erlangen University Hospital, Friedrich-Alexander University of Erlangen–Nürnberg, Erlangen, Germany
Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Amir Fattahi in
Google Scholar
PubMed
Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Amir Fattahi in
Google Scholar
PubMed
Saba Nikanfar
Saba Nikanfar
Department of Clinical Biochemistry and Laboratory Medicine, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
Department of Clinical Biochemistry and Laboratory Medicine, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Saba Nikanfar in
Google Scholar
PubMed
Department of Clinical Biochemistry and Laboratory Medicine, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
Search for other papers by Saba Nikanfar in
Google Scholar
PubMed
Ralf Dittrich
Ralf Dittrich
Department of Obstetrics and Gynecology, Erlangen University Hospital, Friedrich-Alexander University of Erlangen–Nürnberg, Erlangen, Germany
Search for other papers by Ralf Dittrich in
Google Scholar
PubMed
Search for other papers by Ralf Dittrich in
Google Scholar
PubMed
Sullivan S Harten I Schneider SH Greenberg AS Fried SK . Interleukin-6 regulates human adipose tissue lipid metabolism and leptin production in vitro . Journal of Clinical Endocrinology and Metabolism 2004 89 5577 – 5582 . ( https://doi.org/10
Hong-Fa Yan
Hong-Fa Yan
College of Life and Health Sciences, Northeastern University, Shenyang, China
Search for other papers by Hong-Fa Yan in
Google Scholar
PubMed
Search for other papers by Hong-Fa Yan in
Google Scholar
PubMed
Zhao-Yu Liu
Zhao-Yu Liu
College of Life and Health Sciences, Northeastern University, Shenyang, China
Search for other papers by Zhao-Yu Liu in
Google Scholar
PubMed
Search for other papers by Zhao-Yu Liu in
Google Scholar
PubMed
Zhi-Ang Guan
Zhi-Ang Guan
College of Life and Health Sciences, Northeastern University, Shenyang, China
Search for other papers by Zhi-Ang Guan in
Google Scholar
PubMed
Search for other papers by Zhi-Ang Guan in
Google Scholar
PubMed
Chuang Guo
Chuang Guo
College of Life and Health Sciences, Northeastern University, Shenyang, China
Search for other papers by Chuang Guo in
Google Scholar
PubMed
Search for other papers by Chuang Guo in
Google Scholar
PubMed
Biological Chemistry 1987 262 8975 – 8980 . 41 Lee P Peng H Gelbart T Wang L Beutler E. Regulation of hepcidin transcription by interleukin-1 and interleukin-6 . PNAS 2005 102 1906 – 1910 . ( https://doi.org/10.1073/pnas.0409808102 ) 10
Michael C Velarde
Michael C Velarde
Institute of Biology, College of Science, University of the Philippines Diliman, Quezon, Metro Manila, Philippines
Search for other papers by Michael C Velarde in
Google Scholar
PubMed
Search for other papers by Michael C Velarde in
Google Scholar
PubMed
Mikaela Erlinda M Bucu
Mikaela Erlinda M Bucu
Department of Obstetrics and Gynecology, College of Medicine, University of the Philippines Manila, Metro Manila, Philippines
Search for other papers by Mikaela Erlinda M Bucu in
Google Scholar
PubMed
Search for other papers by Mikaela Erlinda M Bucu in
Google Scholar
PubMed
Maria Antonia E Habana
Maria Antonia E Habana
Department of Obstetrics and Gynecology, College of Medicine, University of the Philippines Manila, Metro Manila, Philippines
Search for other papers by Maria Antonia E Habana in
Google Scholar
PubMed
Search for other papers by Maria Antonia E Habana in
Google Scholar
PubMed
-inflammatory cytokines TNF-α and interleukin-6 (IL-6) also contain polymorphisms that have been linked to endometriosis. The −1031T/C polymorphism in the TNF-α gene reduces the risk of endometriosis, while −238A/G and −174C/G gene polymorphisms in the TNF-α and IL-6
Zeting Li
Zeting Li
Department of Endocrinology, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China
Search for other papers by Zeting Li in
Google Scholar
PubMed
Search for other papers by Zeting Li in
Google Scholar
PubMed
Ling Pei
Ling Pei
Department of Endocrinology, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China
Search for other papers by Ling Pei in
Google Scholar
PubMed
Search for other papers by Ling Pei in
Google Scholar
PubMed
Huangmeng Xiao
Huangmeng Xiao
Department of Endocrinology, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China
Search for other papers by Huangmeng Xiao in
Google Scholar
PubMed
Search for other papers by Huangmeng Xiao in
Google Scholar
PubMed
Nan Chen
Nan Chen
Department of Endocrinology, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China
Search for other papers by Nan Chen in
Google Scholar
PubMed
Search for other papers by Nan Chen in
Google Scholar
PubMed
Fenghua Lai
Fenghua Lai
Department of Endocrinology, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China
Search for other papers by Fenghua Lai in
Google Scholar
PubMed
Search for other papers by Fenghua Lai in
Google Scholar
PubMed
Shufang Yue
Shufang Yue
Department of Endocrinology, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China
Search for other papers by Shufang Yue in
Google Scholar
PubMed
Search for other papers by Shufang Yue in
Google Scholar
PubMed
Changliu Xu
Changliu Xu
Department of Endocrinology, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China
Search for other papers by Changliu Xu in
Google Scholar
PubMed
Search for other papers by Changliu Xu in
Google Scholar
PubMed
Yanbing Li
Yanbing Li
Department of Endocrinology, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China
Search for other papers by Yanbing Li in
Google Scholar
PubMed
Search for other papers by Yanbing Li in
Google Scholar
PubMed
Haipeng Xiao
Haipeng Xiao
Department of Endocrinology, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China
Search for other papers by Haipeng Xiao in
Google Scholar
PubMed
Search for other papers by Haipeng Xiao in
Google Scholar
PubMed
Xiaopei Cao
Xiaopei Cao
Department of Endocrinology, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China
Search for other papers by Xiaopei Cao in
Google Scholar
PubMed
Search for other papers by Xiaopei Cao in
Google Scholar
PubMed
B Habib AM Baggio LL Meier DT Eppler E Bouzakri K Wueest S Muller YD , et al. Interleukin-6 enhances insulin secretion by increasing glucagon-like peptide-1 secretion from L cells and alpha cells . Nature Medicine 2011 17 1481 – 1489
Yun Hu
Yun Hu
Department of Endocrinology, Nanjing First Hospital, Nanjing Medical University, Jiangsu, China
Department of Immunology, Nanjing Medical University, Jiangsu, China
Search for other papers by Yun Hu in
Google Scholar
PubMed
Department of Immunology, Nanjing Medical University, Jiangsu, China
Search for other papers by Yun Hu in
Google Scholar
PubMed
Na Li
Na Li
Department of Endocrinology, Nanjing First Hospital, Nanjing Medical University, Jiangsu, China
Search for other papers by Na Li in
Google Scholar
PubMed
Search for other papers by Na Li in
Google Scholar
PubMed
Peng Jiang
Peng Jiang
Department of Thyroid and Breast Surgery, Nanjing First Hospital, Nanjing Medical University, Jiangsu, China
Search for other papers by Peng Jiang in
Google Scholar
PubMed
Search for other papers by Peng Jiang in
Google Scholar
PubMed
Liang Cheng
Liang Cheng
Department of Endocrinology, Nanjing First Hospital, Nanjing Medical University, Jiangsu, China
Search for other papers by Liang Cheng in
Google Scholar
PubMed
Search for other papers by Liang Cheng in
Google Scholar
PubMed
Bo Ding
Bo Ding
Department of Endocrinology, Nanjing First Hospital, Nanjing Medical University, Jiangsu, China
Search for other papers by Bo Ding in
Google Scholar
PubMed
Search for other papers by Bo Ding in
Google Scholar
PubMed
Xiao-Mei Liu
Xiao-Mei Liu
Department of Endocrinology, Nanjing First Hospital, Nanjing Medical University, Jiangsu, China
Search for other papers by Xiao-Mei Liu in
Google Scholar
PubMed
Search for other papers by Xiao-Mei Liu in
Google Scholar
PubMed
Ke He
Ke He
Department of Endocrinology, Wuxi Hospital Affiliated to Nanjing University of Chinese Medicine, Jiangsu, China
Search for other papers by Ke He in
Google Scholar
PubMed
Search for other papers by Ke He in
Google Scholar
PubMed
Yun-Qing Zhu
Yun-Qing Zhu
Department of Endocrinology, Nanjing First Hospital, Nanjing Medical University, Jiangsu, China
Search for other papers by Yun-Qing Zhu in
Google Scholar
PubMed
Search for other papers by Yun-Qing Zhu in
Google Scholar
PubMed
Bing-li Liu
Bing-li Liu
Department of Endocrinology, Nanjing First Hospital, Nanjing Medical University, Jiangsu, China
Search for other papers by Bing-li Liu in
Google Scholar
PubMed
Search for other papers by Bing-li Liu in
Google Scholar
PubMed
Xin Cao
Xin Cao
Department of Endocrinology, Nanjing First Hospital, Nanjing Medical University, Jiangsu, China
Search for other papers by Xin Cao in
Google Scholar
PubMed
Search for other papers by Xin Cao in
Google Scholar
PubMed
Hong Zhou
Hong Zhou
Department of Immunology, Nanjing Medical University, Jiangsu, China
Search for other papers by Hong Zhou in
Google Scholar
PubMed
Search for other papers by Hong Zhou in
Google Scholar
PubMed
Xiao-Ming Mao
Xiao-Ming Mao
Department of Endocrinology, Nanjing First Hospital, Nanjing Medical University, Jiangsu, China
Search for other papers by Xiao-Ming Mao in
Google Scholar
PubMed
Search for other papers by Xiao-Ming Mao in
Google Scholar
PubMed
TGF-β AACGAACTGGCTGTCTGC CCTCTGCTCATTCCGCTTAG IL-10 GCTGGAGGACTTTAAGGGTTAC ATGTCTGGGTCTTGGTTC FOXP-3 , Forkhead box P3; IL-10 , interleukin-10; TGF-β , transforming growth factor-β. Flow cytometric analysis of
